Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2262 are 1
Results from 0 - 25
siRNA sequence "aaccgcuaccguauuggaaac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaccgcuaccguauuggaaac" SARS Coronavirus" Virus reference Genome sequences

Browse all the records for "SARS Coronavirus" virus
Browse "virsi2262 " record
Length: 21
GC Content:48 %
Starting position: 26968
Strain of Virus: HKU-66078
GenBank Acc: AY304494
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):36
Length: 21
GC Content:48 %
Starting position: 26968
Strain of Virus: HKU-66078
GenBank Acc: AY304494
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):36
Offtargets for "aaccgcuaccguauuggaaac" siRNA in Human Genome sequences
See AY304494 at Genbank
Pubmed:15259899
Article:Prophylactic and therapeutic effects of small interfering RNA targeting SARS-coronavirus.
Authors:Zheng BJ, Guan Y, Tang Q, Du C, Xie FY, He ML, Chan KW, Wong KL, Lader E, Woodle MC, Lu PY, Li B, Zhong N.
Journal:Antivir Ther. 2004 Jun;9(3):365-74.
Entrez:15259899
Article:Prophylactic and therapeutic effects of small interfering RNA targeting SARS-coronavirus.
Authors:Zheng BJ, Guan Y, Tang Q, Du C, Xie FY, He ML, Chan KW, Wong KL, Lader E, Woodle MC, Lu PY, Li B, Zhong N.
Journal:Antivir Ther. 2004 Jun;9(3):365-74.
Entrez:15259899
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2262 | aaccgcuaccguauuggaaac | SARS Coronavirus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm