Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2320 are 1
Results from 0 - 25
siRNA sequence "aggcguacgucgaucgaucgg" alignment with "Semliki Forest Virus" virus reference Genome sequences
siRNA sequence matching with "aggcguacgucgaucgaucgg" Semliki Forest Virus" Virus reference Genome sequences

Browse all the records for "Semliki Forest Virus" virus
Browse "virsi2320 " record
Length: 21
GC Content:62 %
Strain of Virus: SFV15
GenBank Acc: AJ251359
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:62 %
Strain of Virus: SFV15
GenBank Acc: AJ251359
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "aggcguacgucgaucgaucgg" siRNA in Human Genome sequences
See AJ251359 at Genbank
Pubmed:21191029
Article:Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.
Authors:Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.
Journal:J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.
Entrez:21191029
Article:Antiviral RNA interference responses induced by Semliki Forest virus infection of mosquito cells: characterization, origin, and frequency-dependent functions of virus-derived small interfering RNAs.
Authors:Siu RW, Fragkoudis R, Simmonds P, Donald CL, Chase-Topping ME, Barry G, Attarzadeh-Yazdi G, Rodriguez-Andres J, Nash AA, Merits A, Fazakerley JK, Kohl A.
Journal:J Virol. 2011 Mar;85(6):2907-17. Epub 2010 Dec 29.
Entrez:21191029
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2320 | aggcguacgucgaucgaucgg | Semliki Forest Virus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm