Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2331 are 1
Results from 0 - 25
siRNA sequence "aguuguuagucuacguggac" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "aguuguuagucuacguggac" Dengue Virus [DENV]" Virus reference Genome sequences

Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2331 " record
Length: 20
GC Content:45 %
Starting position: 1
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 20
GC Content:45 %
Starting position: 1
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "aguuguuagucuacguggac" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2331 | aguuguuagucuacguggac | Dengue Virus [DENV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm