Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi3007 are 1
Results from 0 - 25
siRNA sequence "aaccucaaagaaaaaccaaag" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi3007 " record
Length: 21
GC Content:33 %
Starting position: 358
GenBank Acc: FN675942
Transfection Reagent: Oligofectamine
Length: 21
GC Content:33 %
Starting position: 358
GenBank Acc: FN675942
Transfection Reagent: Oligofectamine
Offtargets for "aaccucaaagaaaaaccaaag" siRNA in Human Genome sequences
See FN675942 at Genbank
Pubmed:17052275
Article:siRNA-resistance in treated HCV replicon cells is correlated with the development of specific HCV mutations.
Authors:Konishi M, Wu CH, Kaito M, Hayashi K, Watanabe S, Adachi Y, Wu GY.
Journal:J Viral Hepat. 2006 Nov;13(11):756-61.
Entrez:17052275
Article:siRNA-resistance in treated HCV replicon cells is correlated with the development of specific HCV mutations.
Authors:Konishi M, Wu CH, Kaito M, Hayashi K, Watanabe S, Adachi Y, Wu GY.
Journal:J Viral Hepat. 2006 Nov;13(11):756-61.
Entrez:17052275
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi3007 | aaccucaaagaaaaaccaaag | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm