Cancertope

In silico Platform for designing genome-based
Personalized immunotherapy or Vaccine against Cancer

Browse Results ...


The result page of search shows exclusive peptide/epitopes generated due to mutation [Neoepitope], the tissue of origin [Tissue], position of peptide in protein [Position], number of mismatches counted by aligning mutated and normal protein sequence [Num Mismatch, percentage of cell lines with this peptide over total number of cell lines [Promiscuity %]. The immune information include CTL epitopes (Yes/No), MHC I binders, MHC II binders (both given as number of alleles) and B cell epitopes (Yes/No). For more information, please click HERE


Result Reset Search:
ProteinNeoepitopesTissuePositionProt MutationcDNA MutationMutation TypeNum MismatchPromiscuity (%)Cell LineCTLMHC INHLApredMHC IIBcell
ABL1DYRMEHPEGBONE474p.R479Hc.1436G>AMissense_Mutation10.11HS821TN000N
ABL1EHPEGCPEKBONE478p.R479Hc.1436G>AMissense_Mutation10.11HS821TN000N
ABL1EKDYRMEHPBONE472p.R479Hc.1436G>AMissense_Mutation10.11HS821TN000N
ABL1HPEGCPEKVBONE479p.R479Hc.1436G>AMissense_Mutation10.11HS821TN1000N
ABL1KDYRMEHPEBONE473p.R479Hc.1436G>AMissense_Mutation10.11HS821TN100N
ABL1LEKDYRMEHBONE471p.R479Hc.1436G>AMissense_Mutation10.11HS821TN008N
ABL1MEHPEGCPEBONE477p.R479Hc.1436G>AMissense_Mutation10.11HS821TN000N
ABL1RMEHPEGCPBONE476p.R479Hc.1436G>AMissense_Mutation10.11HS821TN000N
ABL1YRMEHPEGCBONE475p.R479Hc.1436G>AMissense_Mutation10.11HS821TN4016N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A673N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL78N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HOSN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS706TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS737TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS819TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS821TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS822TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS863TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS888TN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MG63N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MHHES1N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SAOS2N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SJSA1N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKES1N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNMCN000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1353N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86T173N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TC71N000N
AKAP12AIEEDLEPEBONE1529p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86U2OSN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A673N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL78N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HOSN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS706TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS737TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS819TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS821TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS822TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS863TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS888TN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MG63N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MHHES1N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SAOS2N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SJSA1N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKES1N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNMCN000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1353N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86T173N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TC71N000N
AKAP12EEDLEPENGBONE1531p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86U2OSN000N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A673N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL78N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HOSN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS706TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS737TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS819TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS821TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS822TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS863TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS888TN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MG63N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MHHES1N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SAOS2N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SJSA1N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKES1N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNMCN200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1353N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86T173N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TC71N200N
AKAP12IEEDLEPENBONE1530p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86U2OSN200N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86A673N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86CAL78N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HOSN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS706TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS737TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS819TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS821TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS822TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS863TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86HS888TN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MG63N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86MHHES1N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SAOS2N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SJSA1N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKES1N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SKNMCN000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86SW1353N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86T173N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86TC71N000N
AKAP12KVSVAIEEDBONE1525p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins280.86U2OSN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A673N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL78N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HOSN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS706TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS737TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS819TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS821TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS822TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS863TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS888TN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MG63N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MHHES1N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SAOS2N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SJSA1N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKES1N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNMCN000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1353N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86T173N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TC71N000N
AKAP12SVAIEEDLEBONE1527p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86U2OSN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86A673N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86CAL78N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HOSN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS706TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS737TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS819TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS821TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS822TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS863TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86HS888TN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MG63N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86MHHES1N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SAOS2N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SJSA1N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKES1N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SKNMCN000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86SW1353N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86T173N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86TC71N000N
AKAP12VAIEEDLEPBONE1528p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins480.86U2OSN000N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86A673N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86CAL78N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HOSN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS706TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS737TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS819TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS821TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS822TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS863TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86HS888TN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MG63N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86MHHES1N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SAOS2N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SJSA1N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKES1N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SKNMCN002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86SW1353N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86T173N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86TC71N002N
AKAP12VKVSVAIEEBONE1524p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins180.86U2OSN002N
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86A673N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86CAL78N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HOSN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS706TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS737TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS819TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS821TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS822TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS863TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86HS888TN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MG63N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86MHHES1N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SAOS2N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SJSA1N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKES1N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SKNMCN1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86SW1353N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86T173N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86TC71N1500Y
AKAP12VSVAIEEDLBONE1526p.1531_1532insEc.4590_4591insGAGIn_Frame_Ins380.86U2OSN1500Y
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CADOES1N000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAL78N000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS706TN000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS737TN000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS821TN000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS822TN000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MHHES1N000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SAOS2N000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SJSA1N000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKNMCN000N
AKAP9DLEKTKQLEBONE1330p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T173N000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CADOES1N000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAL78N000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS706TN000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS737TN000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS821TN000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS822TN000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MHHES1N000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SAOS2N000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SJSA1N000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKNMCN000N
AKAP9EKTKQLEEQBONE1332p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T173N000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CADOES1N000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAL78N000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS706TN000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS737TN000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS821TN000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS822TN000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MHHES1N000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SAOS2N000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SJSA1N000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKNMCN000N
AKAP9KQLEEQVQEBONE1335p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T173N000N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CADOES1N200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27CAL78N200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS706TN200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS737TN200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS821TN200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27HS822TN200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27MHHES1N200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SAOS2N200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SJSA1N200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27SKNMCN200N
AKAP9KTKQLEEQVBONE1333p.1335_1336insQc.4003_4004insAACIn_Frame_Ins440.27T173N200N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CADOES1N000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAL78N000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS706TN000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS737TN000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS821TN000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS822TN000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MHHES1N000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SAOS2N000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SJSA1N000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKNMCN000N
AKAP9LEKTKQLEEBONE1331p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T173N000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CADOES1N000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAL78N000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS706TN000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS737TN000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS821TN000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS822TN000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MHHES1N000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SAOS2N000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SJSA1N000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKNMCN000N
AKAP9LQDLEKTKQBONE1328p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27T173N000N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CADOES1N900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27CAL78N900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS706TN900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS737TN900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS821TN900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27HS822TN900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27MHHES1N900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SAOS2N900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SJSA1N900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27SKNMCN900N
AKAP9QDLEKTKQLBONE1329p.1335_1336insQc.4003_4004insAACIn_Frame_Ins240.27T173N900N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CADOES1N1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27CAL78N1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS706TN1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS737TN1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS821TN1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27HS822TN1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27MHHES1N1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SAOS2N1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SJSA1N1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27SKNMCN1200N
AKAP9QLEEQVQELBONE1336p.1335_1336insQc.4003_4004insAACIn_Frame_Ins140.27T173N1200N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CADOES1N000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27CAL78N000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS706TN000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS737TN000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS821TN000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27HS822TN000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27MHHES1N000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SAOS2N000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SJSA1N000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27SKNMCN000N
AKAP9TKQLEEQVQBONE1334p.1335_1336insQc.4003_4004insAACIn_Frame_Ins340.27T173N000N
AKAP9ASETRRNSTBONE247p.L251Rc.752T>GMissense_Mutation10.11CAL78N200N
AKAP9EISKLQDLQBONE698p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN100N
AKAP9ETRRNSTHSBONE249p.L251Rc.752T>GMissense_Mutation10.11CAL78N000N
AKAP9ILEISKLQDBONE696p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN002N
AKAP9ISKLQDLQQBONE699p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN000N
AKAP9KLQDLQQSLBONE701p.K703Qc.2107A>CMissense_Mutation10.11SKNMCY17110N
AKAP9LEISKLQDLBONE697p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN1302N
AKAP9LILEISKLQBONE695p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN003N
AKAP9LQASETRRNBONE245p.L251Rc.752T>GMissense_Mutation10.11CAL78N002N
AKAP9LQDLQQSLVBONE702p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN600N
AKAP9QASETRRNSBONE246p.L251Rc.752T>GMissense_Mutation10.11CAL78N100N
AKAP9QDLQQSLVNBONE703p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN100N
AKAP9QLQASETRRBONE244p.L251Rc.752T>GMissense_Mutation10.11CAL78N500N
AKAP9QQLQASETRBONE243p.L251Rc.752T>GMissense_Mutation10.11CAL78N600N
AKAP9RRNSTHSSTBONE251p.L251Rc.752T>GMissense_Mutation10.11CAL78N200N
AKAP9SETRRNSTHBONE248p.L251Rc.752T>GMissense_Mutation10.11CAL78N000N
AKAP9SKLQDLQQSBONE700p.K703Qc.2107A>CMissense_Mutation10.11SKNMCN100N
AKAP9TRRNSTHSSBONE250p.L251Rc.752T>GMissense_Mutation10.11CAL78N200N
ALPK2AFKKFLTCPBONE1387p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS819TN000N
ALPK2DHTAFKKFLBONE1384p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS819TN600N
ALPK2HTAFKKFLTBONE1385p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del313.27HS819TN100N
ALPK2KMDHTAFKKBONE1382p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS819TN600N
ALPK2LKMDHTAFKBONE1381p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del113.27HS819TN1017N
ALPK2MDHTAFKKFBONE1383p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS819TN600N
ALPK2TAFKKFLTCBONE1386p.1388_1389FF>Fc.4164_4166delCTTIn_Frame_Del213.27HS819TN600N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HOSY1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS706TY1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS821TY1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74HS822TY1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MG63Y1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74MHHES1Y1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SKES1Y1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74SKNMCY1140N
ALPK2ATRETVTIABONE1001p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del433.74U2OSY1140N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HOSY2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS706TY2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS821TY2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS822TY2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MG63Y2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MHHES1Y2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKES1Y2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKNMCY2110N
ALPK2CFQATRETVBONE998p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74U2OSY2110N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HOSN400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS706TN400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS821TN400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74HS822TN400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MG63N400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74MHHES1N400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKES1N400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74SKNMCN400N
ALPK2ETVTIATEVBONE1004p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del133.74U2OSN400N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HOSN600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS706TN600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS821TN600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS822TN600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MG63N600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MHHES1N600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKES1N600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKNMCN600N
ALPK2FQATRETVTBONE999p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74U2OSN600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HOSN600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS706TN600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS821TN600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS822TN600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MG63N600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MHHES1N600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKES1N600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKNMCN600N
ALPK2QATRETVTIBONE1000p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74U2OSN600N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HOSN100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS706TN100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS821TN100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74HS822TN100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MG63N100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74MHHES1N100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKES1N100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74SKNMCN100N
ALPK2RETVTIATEBONE1003p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del233.74U2OSN100N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HOSN200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS706TN200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS821TN200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74HS822TN200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MG63N200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74MHHES1N200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKES1N200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74SKNMCN200N
ALPK2TRETVTIATBONE1002p.EDTST1006delc.3017_3031delAGGACACATCAACTGIn_Frame_Del333.74U2OSN200N
BRAFATEKSRWSGBONE598p.V600Ec.1799T>AMissense_Mutation16.08A673N000N
BRAFDFGLATEKSBONE594p.V600Ec.1799T>AMissense_Mutation16.08A673N000N
BRAFEKSRWSGSHBONE600p.V600Ec.1799T>AMissense_Mutation16.08A673N100N
BRAFFGLATEKSRBONE595p.V600Ec.1799T>AMissense_Mutation16.08A673N302N
BRAFGDFGLATEKBONE593p.V600Ec.1799T>AMissense_Mutation16.08A673N100N
BRAFGLATEKSRWBONE596p.V600Ec.1799T>AMissense_Mutation16.08A673N400N
BRAFIGDFGLATEBONE592p.V600Ec.1799T>AMissense_Mutation16.08A673N000N
BRAFLATEKSRWSBONE597p.V600Ec.1799T>AMissense_Mutation16.08A673N200N
BRAFTEKSRWSGSBONE599p.V600Ec.1799T>AMissense_Mutation16.08A673N300N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAL78N100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HOSN100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS706TN100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS822TN100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS863TN100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS888TN100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MHHES1N100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SJSA1N100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKNMCN100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86T173N100N
CHD1DQRSYGSRSBONE1680p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TC71N100N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86CAL78N000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HOSN000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS706TN000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS822TN000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS863TN000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86HS888TN000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86MHHES1N000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SJSA1N000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86SKNMCN000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86T173N000N
CHD1LDQRSYGSRBONE1679p.P1684delc.5050_5052delCCTIn_Frame_Del430.86TC71N000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAL78N000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HOSN000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS706TN000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS822TN000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS863TN000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS888TN000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MHHES1N000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SJSA1N000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKNMCN000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86T173N000N
CHD1PLDQRSYGSBONE1678p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TC71N000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86CAL78N000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HOSN000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS706TN000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS822TN000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS863TN000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86HS888TN000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86MHHES1N000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SJSA1N000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86SKNMCN000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86T173N000N
CHD1QRSYGSRSPBONE1681p.P1684delc.5050_5052delCCTIn_Frame_Del330.86TC71N000N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAL78N600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HOSN600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS706TN600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS822TN600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS863TN600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS888TN600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MHHES1N600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SJSA1N600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKNMCN600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86T173N600N
CHD1RSPLDQRSYBONE1676p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TC71N600N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAL78N900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HOSN900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS706TN900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS822TN900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS863TN900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS888TN900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MHHES1N900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SJSA1N900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKNMCN900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86T173N900N
CHD1RSYGSRSPFBONE1682p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TC71N900N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86CAL78N000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HOSN000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS706TN000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS822TN000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS863TN000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86HS888TN000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86MHHES1N000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SJSA1N000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86SKNMCN000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86T173N000N
CHD1SPLDQRSYGBONE1677p.P1684delc.5050_5052delCCTIn_Frame_Del230.86TC71N000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86CAL78N000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HOSN000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS706TN000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS822TN000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS863TN000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86HS888TN000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86MHHES1N000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SJSA1N000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86SKNMCN000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86T173N000N
CHD1SYGSRSPFEBONE1683p.P1684delc.5050_5052delCCTIn_Frame_Del130.86TC71N000N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47HS706TN801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47HS821TN801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47HS888TN801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47MHHES1N801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47SJSA1N801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47SKNMCN801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47T173N801N
CREB3L2FTHITSDSFBONE95p.T100delc.299_301delCCAIn_Frame_Del444.47U2OSN801N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47HS706TN000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47HS821TN000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47HS888TN000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47MHHES1N000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47SJSA1N000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47SKNMCN000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47T173N000N
CREB3L2HITSDSFNDBONE97p.T100delc.299_301delCCAIn_Frame_Del244.47U2OSN000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47HS706TN000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47HS821TN000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47HS888TN000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47MHHES1N000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47SJSA1N000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47SKNMCN000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47T173N000N
CREB3L2ITSDSFNDDBONE98p.T100delc.299_301delCCAIn_Frame_Del144.47U2OSN000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47HS706TN000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47HS821TN000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47HS888TN000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47MHHES1N000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47SJSA1N000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47SKNMCN000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47T173N000N
CREB3L2PFTHITSDSBONE94p.T100delc.299_301delCCAIn_Frame_Del344.47U2OSN000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47HS706TN000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47HS821TN000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47HS888TN000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47MHHES1N000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47SJSA1N000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47SKNMCN000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47T173N000N
CREB3L2QSPFTHITSBONE92p.T100delc.299_301delCCAIn_Frame_Del144.47U2OSN000N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47HS706TN100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47HS821TN100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47HS888TN100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47MHHES1N100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47SJSA1N100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47SKNMCN100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47T173N100N
CREB3L2SPFTHITSDBONE93p.T100delc.299_301delCCAIn_Frame_Del244.47U2OSN100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47HS706TN100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47HS821TN100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47HS888TN100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47MHHES1N100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47SJSA1N100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47SKNMCN100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47T173N100N
CREB3L2THITSDSFNBONE96p.T100delc.299_301delCCAIn_Frame_Del344.47U2OSN100N
CTBP2APSPNQPTNBONE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HS737TN300N
CTBP2APSPNQPTNBONE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HS819TN300N
CTBP2APSPNQPTNBONE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34HS863TN300N
CTBP2APSPNQPTNBONE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SAOS2N300N
CTBP2APSPNQPTNBONE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34SW1353N300N
CTBP2APSPNQPTNBONE966p.K974fsc.2922_2922delAFrame_Shift_Del124.34TC71N300N
CTBP2GTIESTPTSBONE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN100N
CTBP2GTIESTPTSBONE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN100N
CTBP2GTIESTPTSBONE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN100N
CTBP2GTIESTPTSBONE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N100N
CTBP2GTIESTPTSBONE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N100N
CTBP2GTIESTPTSBONE976p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N100N
CTBP2NQPTNTGTIBONE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HS737TN1000N
CTBP2NQPTNTGTIBONE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HS819TN1000N
CTBP2NQPTNTGTIBONE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34HS863TN1000N
CTBP2NQPTNTGTIBONE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SAOS2N1000N
CTBP2NQPTNTGTIBONE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34SW1353N1000N
CTBP2NQPTNTGTIBONE970p.K974fsc.2922_2922delAFrame_Shift_Del424.34TC71N1000N
CTBP2NTGTIESTPBONE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN000N
CTBP2NTGTIESTPBONE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN000N
CTBP2NTGTIESTPBONE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN000N
CTBP2NTGTIESTPBONE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N000N
CTBP2NTGTIESTPBONE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N000N
CTBP2NTGTIESTPBONE974p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N000N
CTBP2PNQPTNTGTBONE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HS737TN000N
CTBP2PNQPTNTGTBONE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HS819TN000N
CTBP2PNQPTNTGTBONE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34HS863TN000N
CTBP2PNQPTNTGTBONE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SAOS2N000N
CTBP2PNQPTNTGTBONE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34SW1353N000N
CTBP2PNQPTNTGTBONE969p.K974fsc.2922_2922delAFrame_Shift_Del324.34TC71N000N
CTBP2PSPNQPTNTBONE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS737TN000N
CTBP2PSPNQPTNTBONE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS819TN000N
CTBP2PSPNQPTNTBONE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS863TN000N
CTBP2PSPNQPTNTBONE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SAOS2N000N
CTBP2PSPNQPTNTBONE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW1353N000N
CTBP2PSPNQPTNTBONE967p.K974fsc.2922_2922delAFrame_Shift_Del224.34TC71N000N
CTBP2PTNTGTIESBONE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN000N
CTBP2PTNTGTIESBONE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN000N
CTBP2PTNTGTIESBONE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN000N
CTBP2PTNTGTIESBONE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N000N
CTBP2PTNTGTIESBONE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N000N
CTBP2PTNTGTIESBONE972p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N000N
CTBP2QPTNTGTIEBONE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN000N
CTBP2QPTNTGTIEBONE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN000N
CTBP2QPTNTGTIEBONE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN000N
CTBP2QPTNTGTIEBONE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N000N
CTBP2QPTNTGTIEBONE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N000N
CTBP2QPTNTGTIEBONE971p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N000N
CTBP2SPNQPTNTGBONE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS737TN000N
CTBP2SPNQPTNTGBONE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS819TN000N
CTBP2SPNQPTNTGBONE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34HS863TN000N
CTBP2SPNQPTNTGBONE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SAOS2N000N
CTBP2SPNQPTNTGBONE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34SW1353N000N
CTBP2SPNQPTNTGBONE968p.K974fsc.2922_2922delAFrame_Shift_Del224.34TC71N000N
CTBP2TGTIESTPTBONE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN000N
CTBP2TGTIESTPTBONE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN000N
CTBP2TGTIESTPTBONE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN000N
CTBP2TGTIESTPTBONE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N000N
CTBP2TGTIESTPTBONE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N000N
CTBP2TGTIESTPTBONE975p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N000N
CTBP2TIESTPTSNBONE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN100N
CTBP2TIESTPTSNBONE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN100N
CTBP2TIESTPTSNBONE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN100N
CTBP2TIESTPTSNBONE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N100N
CTBP2TIESTPTSNBONE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N100N
CTBP2TIESTPTSNBONE977p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N100N
CTBP2TNTGTIESTBONE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS737TN000N
CTBP2TNTGTIESTBONE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS819TN000N
CTBP2TNTGTIESTBONE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34HS863TN000N
CTBP2TNTGTIESTBONE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SAOS2N000N
CTBP2TNTGTIESTBONE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34SW1353N000N
CTBP2TNTGTIESTBONE973p.K974fsc.2922_2922delAFrame_Shift_Del524.34TC71N000N
CTBP2DPGVSWPVPBONE129p.R134Wc.400C>TMissense_Mutation10.22HOSN000N
CTBP2GVSWPVPSYBONE131p.R134Wc.400C>TMissense_Mutation10.22HOSY4120N
CTBP2LYRDPGVSWBONE126p.R134Wc.400C>TMissense_Mutation10.22HOSN305Y
CTBP2PGVSWPVPSBONE130p.R134Wc.400C>TMissense_Mutation10.22HOSN000N
CTBP2RDPGVSWPVBONE128p.R134Wc.400C>TMissense_Mutation10.22HOSY5110N
CTBP2SWPVPSYGVBONE133p.R134Wc.400C>TMissense_Mutation10.22HOSN200N
CTBP2VSWPVPSYGBONE132p.R134Wc.400C>TMissense_Mutation10.22HOSN000N
CTBP2WPVPSYGVLBONE134p.R134Wc.400C>TMissense_Mutation10.22HOSN2400N
CTBP2YRDPGVSWPBONE127p.R134Wc.400C>TMissense_Mutation10.22HOSN300Y
FLT3HPNSSMRGSBONE732p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N400N
FLT3MRGSREVQIBONE737p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N503N
FLT3NSSMRGSREBONE734p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N000N
FLT3PNSSMRGSRBONE733p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N000N
FLT3QSHPNSSMRBONE730p.P738Rc.2213C>GMissense_Mutation10.11MHHES1Y5120N
FLT3RGSREVQIHBONE738p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N000N
FLT3SHPNSSMRGBONE731p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N000N
FLT3SMRGSREVQBONE736p.P738Rc.2213C>GMissense_Mutation10.11MHHES1N000N
FLT3SSMRGSREVBONE735p.P738Rc.2213C>GMissense_Mutation10.11MHHES1Y4100N
FMN2LPPLPGAAIBONE934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03MHHES1N1401N
FMN2LPPLPGAAIBONE934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03OUMS27N1401N
FMN2LPPLPGAAIBONE934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKES1N1401N
FMN2LPPLPGAAIBONE934p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03U2OSN1401N
FMN2PLPPLPGAABONE933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03MHHES1N000N
FMN2PLPPLPGAABONE933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03OUMS27N000N
FMN2PLPPLPGAABONE933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03SKES1N000N
FMN2PLPPLPGAABONE933p.PPLPGAGIPPP939delc.2814_2846delGCCCCCTCTACCCGGAGCGGGAATACCTCCTCCIn_Frame_Del118.03U2OSN000N
FMN2LPPPPPPPPBONE908p.917_918insPPc.2739_2740insCCCCCTIn_Frame_Ins10.22SJSA1N100Y
FMN2MLPPPPPPPBONE907p.917_918insPPc.2739_2740insCCCCCTIn_Frame_Ins10.22SJSA1N000N
FMN2PPPPPPPLPBONE910p.917_918insPPc.2739_2740insCCCCCTIn_Frame_Ins10.22SJSA1N000N
FMN2PPPPPPPPLBONE909p.917_918insPPc.2739_2740insCCCCCTIn_Frame_Ins20.22SJSA1N1000Y
FMN2LPPPLPGVGBONE966p.P973Lc.2918C>TMissense_Mutation10.11OUMS27N100N
FMN2PLPPPLPGVBONE965p.P973Lc.2918C>TMissense_Mutation10.11OUMS27N300N
GPR112ASPEGKVPLBONE707p.G713fsc.2137_2137delGFrame_Shift_Del30.11HOSN1300N
GPR112EGKVPLPMMBONE710p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN400N
GPR112GKVPLPMMLBONE711p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN700N
GPR112KASPEGKVPBONE706p.G713fsc.2137_2137delGFrame_Shift_Del20.11HOSN000N
GPR112KVPLPMMLLBONE712p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSY1590N
GPR112LKASPEGKVBONE705p.G713fsc.2137_2137delGFrame_Shift_Del10.11HOSN400N
GPR112LLQPDIQQLBONE719p.G713fsc.2137_2137delGFrame_Shift_Del40.11HOSN1600N
GPR112LPMMLLQPDBONE715p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN200N
GPR112LQPDIQQLYBONE720p.G713fsc.2137_2137delGFrame_Shift_Del40.11HOSN1007N
GPR112MLLQPDIQQBONE718p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN000N
GPR112MMLLQPDIQBONE717p.G713fsc.2137_2137delGFrame_Shift_Del60.11HOSN0017N
GPR112PDIQQLYPNBONE722p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN000N
GPR112PEGKVPLPMBONE709p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN200N
GPR112PLPMMLLQPBONE714p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN000N
GPR112PMMLLQPDIBONE716p.G713fsc.2137_2137delGFrame_Shift_Del60.11HOSN200N
GPR112QPDIQQLYPBONE721p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN000N
GPR112SPEGKVPLPBONE708p.G713fsc.2137_2137delGFrame_Shift_Del40.11HOSN000N
GPR112VPLPMMLLQBONE713p.G713fsc.2137_2137delGFrame_Shift_Del50.11HOSN300N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CADOES1N000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7CAL78N000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS706TN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS737TN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS819TN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS821TN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS822TN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7HS863TN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7MG63N000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SAOS2N000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SJSA1N000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7SKNMCN000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7T173N000N
GPR112ASISDMFIQBONE2652p.D2657delc.7966_7968delGATIn_Frame_Del466.7U2OSN000N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CADOES1Y11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAL78Y11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS706TY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS737TY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS819TY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS821TY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS822TY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS863TY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7MG63Y11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SAOS2Y11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SJSA1Y11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKNMCY11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7T173Y11100N
GPR112ISDMFIQNLBONE2654p.D2657delc.7966_7968delGATIn_Frame_Del266.7U2OSY11100N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CADOES1N700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAL78N700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS706TN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS737TN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS819TN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS821TN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS822TN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS863TN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7MG63N700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SAOS2N700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SJSA1N700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKNMCN700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7T173N700N
GPR112SASISDMFIBONE2651p.D2657delc.7966_7968delGATIn_Frame_Del366.7U2OSN700N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CADOES1N400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAL78N400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS706TN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS737TN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS819TN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS821TN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS822TN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS863TN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7MG63N400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SAOS2N400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SJSA1N400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKNMCN400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7T173N400N
GPR112SDMFIQNLABONE2655p.D2657delc.7966_7968delGATIn_Frame_Del166.7U2OSN400N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CADOES1N000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7CAL78N000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS706TN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS737TN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS819TN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS821TN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS822TN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7HS863TN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7MG63N000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SAOS2N000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SJSA1N000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7SKNMCN000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7T173N000N
GPR112SISDMFIQNBONE2653p.D2657delc.7966_7968delGATIn_Frame_Del366.7U2OSN000N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CADOES1N900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7CAL78N900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS706TN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS737TN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS819TN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS821TN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS822TN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7HS863TN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7MG63N900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SAOS2N900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SJSA1N900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7SKNMCN900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7T173N900N
GPR112VSASISDMFBONE2650p.D2657delc.7966_7968delGATIn_Frame_Del266.7U2OSN900N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CADOES1N5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7CAL78N5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS706TN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS737TN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS819TN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS821TN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS822TN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7HS863TN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7MG63N5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SAOS2N5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SJSA1N5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7SKNMCN5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7T173N5020N
GPR112VVSASISDMBONE2649p.D2657delc.7966_7968delGATIn_Frame_Del166.7U2OSN5020N
GPR112HVMLQIINIBONE2512p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2Y9120N
GPR112IINIVLEKQBONE2517p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2N005N
GPR112INIVLEKQNBONE2518p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2N000N
GPR112IVLEKQNNSBONE2520p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2N0020N
GPR112LQIINIVLEBONE2515p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2N1021N
GPR112MLQIINIVLBONE2514p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2Y16915N
GPR112NIVLEKQNNBONE2519p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2N000N
GPR112QIINIVLEKBONE2516p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2N400N
GPR112VMLQIINIVBONE2513p.V2520Ic.7558G>AMissense_Mutation10.11SAOS2Y10922N
HSP90B1DEEETAKESBONE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS821TN300N
HSP90B1DEEETAKESBONE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS863TN300N
HSP90B1DEEETAKESBONE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79MHHES1N300N
HSP90B1DEEETAKESBONE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKNMCN300N
HSP90B1DEEETAKESBONE787p.E791delc.2362_2364delGAAIn_Frame_Del121.79U2OSN300N
HSP90B1DVGTDEEETBONE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS821TN200N
HSP90B1DVGTDEEETBONE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79HS863TN200N
HSP90B1DVGTDEEETBONE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79MHHES1N200N
HSP90B1DVGTDEEETBONE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79SKNMCN200N
HSP90B1DVGTDEEETBONE783p.E791delc.2362_2364delGAAIn_Frame_Del121.79U2OSN200N
HSP90B1GTDEEETAKBONE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HS821TN400N
HSP90B1GTDEEETAKBONE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79HS863TN400N
HSP90B1GTDEEETAKBONE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79MHHES1N400N
HSP90B1GTDEEETAKBONE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79SKNMCN400N
HSP90B1GTDEEETAKBONE785p.E791delc.2362_2364delGAAIn_Frame_Del321.79U2OSN400N
HSP90B1TDEEETAKEBONE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS821TN000N
HSP90B1TDEEETAKEBONE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS863TN000N
HSP90B1TDEEETAKEBONE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79MHHES1N000N
HSP90B1TDEEETAKEBONE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKNMCN000N
HSP90B1TDEEETAKEBONE786p.E791delc.2362_2364delGAAIn_Frame_Del221.79U2OSN000N
HSP90B1VGTDEEETABONE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS821TN100N
HSP90B1VGTDEEETABONE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79HS863TN100N
HSP90B1VGTDEEETABONE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79MHHES1N100N
HSP90B1VGTDEEETABONE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79SKNMCN100N
HSP90B1VGTDEEETABONE784p.E791delc.2362_2364delGAAIn_Frame_Del221.79U2OSN100N
KITAKIFLVDRSBONE115p.L117Ic.349C>AMissense_Mutation10.11SW1353N100N
KITCSKQEDYAEBONE691p.H697Yc.2089C>TMissense_Mutation10.11HS819TN000N
KITDPAKIFLVDBONE113p.L117Ic.349C>AMissense_Mutation10.11SW1353N000N
KITDYAEAALYKBONE696p.H697Yc.2089C>TMissense_Mutation10.11HS819TY2110N
KITEDYAEAALYBONE695p.H697Yc.2089C>TMissense_Mutation10.11HS819TN300N
KITFICSKQEDYBONE689p.H697Yc.2089C>TMissense_Mutation10.11HS819TN500N
KITFVRDPAKIFBONE110p.L117Ic.349C>AMissense_Mutation10.11SW1353N6015Y
KITICSKQEDYABONE690p.H697Yc.2089C>TMissense_Mutation10.11HS819TN100N
KITIFLVDRSLYBONE117p.L117Ic.349C>AMissense_Mutation10.11SW1353N201N
KITKIFLVDRSLBONE116p.L117Ic.349C>AMissense_Mutation10.11SW1353N1300N
KITKQEDYAEAABONE693p.H697Yc.2089C>TMissense_Mutation10.11HS819TN300N
KITPAKIFLVDRBONE114p.L117Ic.349C>AMissense_Mutation10.11SW1353N000N
KITQEDYAEAALBONE694p.H697Yc.2089C>TMissense_Mutation10.11HS819TN700N
KITRDPAKIFLVBONE112p.L117Ic.349C>AMissense_Mutation10.11SW1353N600N
KITSKQEDYAEABONE692p.H697Yc.2089C>TMissense_Mutation10.11HS819TN300N
KITVFVRDPAKIBONE109p.L117Ic.349C>AMissense_Mutation10.11SW1353N7010Y
KITVRDPAKIFLBONE111p.L117Ic.349C>AMissense_Mutation10.11SW1353Y990Y
KITYAEAALYKNBONE697p.H697Yc.2089C>TMissense_Mutation10.11HS819TN400N
MAML2DMEPRQGNTBONE548p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N200N
MAML2FINNPHPDMBONE541p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N506N
MAML2HPDMEPRQGBONE546p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N100N
MAML2INNPHPDMEBONE542p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N000N
MAML2LLRSTLPLQBONE679p.P683Tc.2047C>AMissense_Mutation10.11HS863TN107Y
MAML2LRSTLPLQQBONE680p.P683Tc.2047C>AMissense_Mutation10.11HS863TN1035N
MAML2NNPHPDMEPBONE543p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N000N
MAML2NPHPDMEPRBONE544p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N500N
MAML2PDMEPRQGNBONE547p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N000N
MAML2PHPDMEPRQBONE545p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N000N
MAML2PLLRSTLPLBONE678p.P683Tc.2047C>AMissense_Mutation10.11HS863TN300N
MAML2PSQPLLRSTBONE675p.P683Tc.2047C>AMissense_Mutation10.11HS863TN000Y
MAML2QPLLRSTLPBONE677p.P683Tc.2047C>AMissense_Mutation10.11HS863TN000N
MAML2RSTLPLQQKBONE681p.P683Tc.2047C>AMissense_Mutation10.11HS863TN200Y
MAML2SFINNPHPDBONE540p.A548Dc.1643C>AMissense_Mutation10.11SAOS2N100N
MAML2SQPLLRSTLBONE676p.P683Tc.2047C>AMissense_Mutation10.11HS863TN1300Y
MAML2STLPLQQKLBONE682p.P683Tc.2047C>AMissense_Mutation10.11HS863TY1490Y
MAML2TLPLQQKLLBONE683p.P683Tc.2047C>AMissense_Mutation10.11HS863TN1200Y
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44A673N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44CAL78N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HOSN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS706TN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS737TN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS819TN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS822TN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS863TN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44HS888TN000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MG63N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44MHHES1N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44OUMS27N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SJSA1N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SKES1N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44SW1353N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44T173N000N
MAP3K1STTTTTTTEBONE941p.T949delc.2822_2824delCAAIn_Frame_Del176.44U2OSN000N
MAP3K4ELWTLISQSBONE1276p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN000N
MAP3K4LWTLISQSKBONE1277p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN002N
MAP3K4RRSWELWTLBONE1272p.R1278Wc.3832C>TMissense_Mutation10.11U2OSY6100N
MAP3K4RSWELWTLIBONE1273p.R1278Wc.3832C>TMissense_Mutation10.11U2OSY13130N
MAP3K4STRRSWELWBONE1270p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN200N
MAP3K4SWELWTLISBONE1274p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN000N
MAP3K4TRRSWELWTBONE1271p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN200N
MAP3K4WELWTLISQBONE1275p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN208N
MAP3K4WTLISQSKDBONE1278p.R1278Wc.3832C>TMissense_Mutation10.11U2OSN201N
MAP3K4ACKSPESVLBONE60p.D67Vc.200A>TMissense_Mutation10.22CADOES1Y490N
MAP3K4CKSPESVLEBONE61p.D67Vc.200A>TMissense_Mutation10.22CADOES1N000N
MAP3K4ESVLEDFSDBONE65p.D67Vc.200A>TMissense_Mutation10.22CADOES1N000N
MAP3K4KSPESVLEDBONE62p.D67Vc.200A>TMissense_Mutation10.22CADOES1N100N
MAP3K4PESVLEDFSBONE64p.D67Vc.200A>TMissense_Mutation10.22CADOES1N000N
MAP3K4SACKSPESVBONE59p.D67Vc.200A>TMissense_Mutation10.22CADOES1N400N
MAP3K4SPESVLEDFBONE63p.D67Vc.200A>TMissense_Mutation10.22CADOES1N1100N
MAP3K4SVLEDFSDEBONE66p.D67Vc.200A>TMissense_Mutation10.22CADOES1N000N
MAP3K4VLEDFSDETBONE67p.D67Vc.200A>TMissense_Mutation10.22CADOES1N400N
METDFFNKIINKBONE372p.V378Ic.1132G>AMissense_Mutation10.11OUMS27Y2110N
METFFNKIINKNBONE373p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N109N
METFNKIINKNNBONE374p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N201N
METIINKNNVRCBONE377p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N104N
METINKNNVRCLBONE378p.V378Ic.1132G>AMissense_Mutation10.11OUMS27Y91412N
METKIINKNNVRBONE376p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N600N
METNDFFNKIINBONE371p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N100N
METNKIINKNNVBONE375p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N300N
METVNDFFNKIIBONE370p.V378Ic.1132G>AMissense_Mutation10.11OUMS27N700N
MLL3FVLRSHTLNBONE4722p.P4726Sc.14176C>TMissense_Mutation10.11TC71N205N
MLL3HVKRFVLRSBONE4718p.P4726Sc.14176C>TMissense_Mutation10.11TC71N000Y
MLL3KRFVLRSHTBONE4720p.P4726Sc.14176C>TMissense_Mutation10.11TC71N300Y
MLL3LRSHTLNSTBONE4724p.P4726Sc.14176C>TMissense_Mutation10.11TC71N2014N
MLL3RFVLRSHTLBONE4721p.P4726Sc.14176C>TMissense_Mutation10.11TC71Y890N
MLL3RSHTLNSTSBONE4725p.P4726Sc.14176C>TMissense_Mutation10.11TC71N100N
MLL3SHTLNSTSTBONE4726p.P4726Sc.14176C>TMissense_Mutation10.11TC71N300N
MLL3VKRFVLRSHBONE4719p.P4726Sc.14176C>TMissense_Mutation10.11TC71N1020Y
MLL3VLRSHTLNSBONE4723p.P4726Sc.14176C>TMissense_Mutation10.11TC71N0038N
MSH3GAAAAAAPPBONE50p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94HS821TN000N
MSH3PGAAAAAAPBONE49p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del113.94HS821TN000N
MSH3AAAAPPAPABONE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23CAL78N200N
MSH3AAAAPPAPABONE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HOSN200N
MSH3AAAAPPAPABONE53p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23HS821TN200N
MSH3AAAAPPAPABONE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS821TN200N
MSH3AAAAPPAPABONE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS888TN200N
MSH3AAAAPPAPABONE59p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23MHHES1N200N
MSH3AAAPPAPAFBONE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23CAL78Y8100N
MSH3AAAPPAPAFBONE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HOSY8100N
MSH3AAAPPAPAFBONE54p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del222.23HS821TY8100N
MSH3AAAPPAPAFBONE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HS821TY8100N
MSH3AAAPPAPAFBONE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23HS888TY8100N
MSH3AAAPPAPAFBONE60p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del222.23MHHES1Y8100N
MSH3AAPPAPAFPBONE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23CAL78N000N
MSH3AAPPAPAFPBONE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HOSN000N
MSH3AAPPAPAFPBONE55p.AAAAAAAPP56delc.164_190delCAGCGGCCGCAGCGGCCGCAGCGCCCCIn_Frame_Del122.23HS821TN000N
MSH3AAPPAPAFPBONE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS821TN000N
MSH3AAPPAPAFPBONE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23HS888TN000N
MSH3AAPPAPAFPBONE61p.PPA66delc.196_204delCCCCCAGCTIn_Frame_Del122.23MHHES1N000N
MSH6AVSTTRSGABONE716p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N000N
MSH6DAVSTTRSGBONE715p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N000N
MSH6DSDAVSTTRBONE713p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N400N
MSH6EYIPLDSDABONE708p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N400N
MSH6IPLDSDAVSBONE710p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N600N
MSH6LDSDAVSTTBONE712p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N200N
MSH6PLDSDAVSTBONE711p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N000N
MSH6SDAVSTTRSBONE714p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N200N
MSH6YIPLDSDAVBONE709p.T716Ac.2146A>GMissense_Mutation10.11SAOS2N704N
MYLKASKELKKDVBONE1062p.E1066delc.3196_3198delGAAIn_Frame_Del320.02CADOES1N400N
MYLKKELKKDVKNBONE1064p.E1066delc.3196_3198delGAAIn_Frame_Del120.02CADOES1N500N
MYLKKSASKELKKBONE1060p.E1066delc.3196_3198delGAAIn_Frame_Del220.02CADOES1N400N
MYLKLKSASKELKBONE1059p.E1066delc.3196_3198delGAAIn_Frame_Del220.02CADOES1N105N
MYLKNLKSASKELBONE1058p.E1066delc.3196_3198delGAAIn_Frame_Del120.02CADOES1Y5100N
MYLKSASKELKKDBONE1061p.E1066delc.3196_3198delGAAIn_Frame_Del320.02CADOES1N000N
MYLKSKELKKDVKBONE1063p.E1066delc.3196_3198delGAAIn_Frame_Del220.02CADOES1N200N
MYLKAPSKPTGPIBONE616p.A622Gc.1865C>GMissense_Mutation10.11U2OSN1200Y
MYLKGPIFLQGLSBONE622p.A622Gc.1865C>GMissense_Mutation10.11U2OSN400N
MYLKKPTGPIFLQBONE619p.A622Gc.1865C>GMissense_Mutation10.11U2OSN100N
MYLKPSKPTGPIFBONE617p.A622Gc.1865C>GMissense_Mutation10.11U2OSY1100N
MYLKPTGPIFLQGBONE620p.A622Gc.1865C>GMissense_Mutation10.11U2OSN000N
MYLKPVAPSKPTGBONE614p.A622Gc.1865C>GMissense_Mutation10.11U2OSN000Y
MYLKSKPTGPIFLBONE618p.A622Gc.1865C>GMissense_Mutation10.11U2OSY7100N
MYLKTGPIFLQGLBONE621p.A622Gc.1865C>GMissense_Mutation10.11U2OSY1590N
MYLKVAPSKPTGPBONE615p.A622Gc.1865C>GMissense_Mutation10.11U2OSN000Y
NF1CLEYMTQWLBONE1945p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N1100N
NF1EYMTQWLSNBONE1947p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N200N
NF1HLCLEYMTQBONE1943p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N000N
NF1LCLEYMTQWBONE1944p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N300N
NF1LEYMTQWLSBONE1946p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N509N
NF1MTQWLSNLVBONE1949p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N301N
NF1QWLSNLVRFBONE1951p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N300N
NF1TQWLSNLVRBONE1950p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N800N
NF1YMTQWLSNLBONE1948p.P1951Qc.5852C>AMissense_Mutation10.11MHHES1N1400N
NF1AQTKLEMALBONE683p.V689Mc.2065G>AMissense_Mutation10.22HOSN900N
NF1EMALYMFLWBONE688p.V689Mc.2065G>AMissense_Mutation10.22HOSN200N
NF1KLEMALYMFBONE686p.V689Mc.2065G>AMissense_Mutation10.22HOSN900N
NF1LEMALYMFLBONE687p.V689Mc.2065G>AMissense_Mutation10.22HOSY15104N
NF1MALYMFLWNBONE689p.V689Mc.2065G>AMissense_Mutation10.22HOSN103N
NF1QAQTKLEMABONE682p.V689Mc.2065G>AMissense_Mutation10.22HOSN400N
NF1QTKLEMALYBONE684p.V689Mc.2065G>AMissense_Mutation10.22HOSY4130N
NF1RQAQTKLEMBONE681p.V689Mc.2065G>AMissense_Mutation10.22HOSY7110N
NF1TKLEMALYMBONE685p.V689Mc.2065G>AMissense_Mutation10.22HOSN500N
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13A673N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13A673N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CADOES1N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13CADOES1N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAL78N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HOSN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HOSN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS706TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS737TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS819TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS821TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS822TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS863TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS888TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS888TN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13MG63N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13MHHES1N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13OUMS27N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SAOS2N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SJSA1N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKES1N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKNMCN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SKNMCN101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1353N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW1353N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13T173N101Y
NR1H2IRKQQQQQEBONE170p.176_177insQc.514_515insAACIn_Frame_Ins296.13U2OSN101Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13A673N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13A673N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CADOES1N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13CADOES1N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAL78N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HOSN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HOSN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS706TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS737TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS819TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS821TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS822TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS863TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS888TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS888TN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13MG63N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13MHHES1N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13OUMS27N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SAOS2N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SJSA1N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKES1N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKNMCN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SKNMCN000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1353N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW1353N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13T173N000Y
NR1H2KIRKQQQQQBONE169p.176_177insQc.514_515insAACIn_Frame_Ins196.13U2OSN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13A673N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13A673N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CADOES1N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13CADOES1N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13CAL78N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HOSN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HOSN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS706TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS737TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS819TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS821TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS822TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS863TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13HS888TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13HS888TN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13MG63N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13MHHES1N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13OUMS27N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SAOS2N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SJSA1N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKES1N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SKNMCN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SKNMCN000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13SW1353N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.516_517insCAGIn_Frame_Ins296.13SW1353N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13T173N000Y
NR1H2KQQQQQESQBONE172p.176_177insQc.514_515insAACIn_Frame_Ins296.13U2OSN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13A673N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13A673N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CADOES1N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13CADOES1N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13CAL78N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HOSN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HOSN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS706TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS737TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS819TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS821TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS822TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS863TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13HS888TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13HS888TN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13MG63N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13MHHES1N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13OUMS27N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SAOS2N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SJSA1N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKES1N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SKNMCN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SKNMCN000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13SW1353N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.516_517insCAGIn_Frame_Ins196.13SW1353N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13T173N000Y
NR1H2QQQQQESQSBONE173p.176_177insQc.514_515insAACIn_Frame_Ins196.13U2OSN000Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13A673N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13A673N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CADOES1N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13CADOES1N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13CAL78N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HOSN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HOSN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HS706TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HS737TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HS819TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HS821TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HS822TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HS863TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13HS888TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13HS888TN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13MG63N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13MHHES1N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13OUMS27N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SAOS2N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SJSA1N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKES1N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SKNMCN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SKNMCN100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13SW1353N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.516_517insCAGIn_Frame_Ins396.13SW1353N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13T173N100Y
NR1H2RKQQQQQESBONE171p.176_177insQc.514_515insAACIn_Frame_Ins396.13U2OSN100Y
PDE4DIPANLDQGRVRBONE603p.L601fsc.1801_1801delCFrame_Shift_Del615.49OUMS27Y2110N
PDE4DIPATCSANLDQBONE599p.L601fsc.1801_1801delCFrame_Shift_Del615.49OUMS27N000N
PDE4DIPCSANLDQGRBONE601p.L601fsc.1801_1801delCFrame_Shift_Del515.49OUMS27N300N
PDE4DIPDLSATCSANBONE596p.L601fsc.1801_1801delCFrame_Shift_Del415.49OUMS27N000N
PDE4DIPEDLSATCSABONE595p.L601fsc.1801_1801delCFrame_Shift_Del315.49OUMS27N400N
PDE4DIPEVEDLSATCBONE593p.L601fsc.1801_1801delCFrame_Shift_Del115.49OUMS27N200N
PDE4DIPLSATCSANLBONE597p.L601fsc.1801_1801delCFrame_Shift_Del415.49OUMS27N1102N
PDE4DIPSANLDQGRVBONE602p.L601fsc.1801_1801delCFrame_Shift_Del515.49OUMS27N400N
PDE4DIPSATCSANLDBONE598p.L601fsc.1801_1801delCFrame_Shift_Del515.49OUMS27N000N
PDE4DIPTCSANLDQGBONE600p.L601fsc.1801_1801delCFrame_Shift_Del615.49OUMS27N100N
PDE4DIPVEDLSATCSBONE594p.L601fsc.1801_1801delCFrame_Shift_Del215.49OUMS27N300N
PDE4DIPADSRKKSSKBONE242p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N000Y
PDE4DIPDSHLADSRKBONE238p.E243fsc.729_729delAFrame_Shift_Del417.59OUMS27N200N
PDE4DIPDSRKKSSKQBONE243p.E243fsc.729_729delAFrame_Shift_Del417.59OUMS27N200Y
PDE4DIPHLADSRKKSBONE240p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N000N
PDE4DIPKKSSKQRPPBONE246p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N100Y
PDE4DIPKQRPPTRFFBONE250p.E243fsc.729_729delAFrame_Shift_Del617.59OUMS27Y7100Y
PDE4DIPKSSKQRPPTBONE247p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N200Y
PDE4DIPLADSRKKSSBONE241p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N100N
PDE4DIPPPTRFFKRNBONE253p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N000Y
PDE4DIPPTRFFKRNLBONE254p.E243fsc.729_729delAFrame_Shift_Del617.59OUMS27Y2110Y
PDE4DIPQRPPTRFFKBONE251p.E243fsc.729_729delAFrame_Shift_Del617.59OUMS27Y2100Y
PDE4DIPRFFKRNLMKBONE256p.E243fsc.729_729delAFrame_Shift_Del617.59OUMS27Y2130N
PDE4DIPRKKSSKQRPBONE245p.E243fsc.729_729delAFrame_Shift_Del417.59OUMS27N100Y
PDE4DIPRPPTRFFKRBONE252p.E243fsc.729_729delAFrame_Shift_Del617.59OUMS27Y590Y
PDE4DIPSDSHLADSRBONE237p.E243fsc.729_729delAFrame_Shift_Del317.59OUMS27N000N
PDE4DIPSHLADSRKKBONE239p.E243fsc.729_729delAFrame_Shift_Del417.59OUMS27N000N
PDE4DIPSKQRPPTRFBONE249p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27N200Y
PDE4DIPSRKKSSKQRBONE244p.E243fsc.729_729delAFrame_Shift_Del417.59OUMS27Y390Y
PDE4DIPSSKQRPPTRBONE248p.E243fsc.729_729delAFrame_Shift_Del517.59OUMS27Y390Y
PDE4DIPSVSDSHLADBONE235p.E243fsc.729_729delAFrame_Shift_Del117.59OUMS27N000N
PDE4DIPTRFFKRNLMBONE255p.E243fsc.729_729delAFrame_Shift_Del617.59OUMS27Y390Y
PDE4DIPVSDSHLADSBONE236p.E243fsc.729_729delAFrame_Shift_Del217.59OUMS27N100N
PDE4DIPDKAVLWSGLBONE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58CAL78N400N
PDE4DIPDKAVLWSGLBONE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58HS819TN400N
PDE4DIPDKAVLWSGLBONE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58HS821TN400N
PDE4DIPDKAVLWSGLBONE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SAOS2N400N
PDE4DIPDKAVLWSGLBONE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58SKES1N400N
PDE4DIPDKAVLWSGLBONE483p.V486fsc.1458_1458delTFrame_Shift_Del518.58U2OSN400N
PDE4DIPHDKAVLWSGBONE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58CAL78N000N
PDE4DIPHDKAVLWSGBONE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58HS819TN000N
PDE4DIPHDKAVLWSGBONE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58HS821TN000N
PDE4DIPHDKAVLWSGBONE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SAOS2N000N
PDE4DIPHDKAVLWSGBONE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58SKES1N000N
PDE4DIPHDKAVLWSGBONE482p.V486fsc.1458_1458delTFrame_Shift_Del418.58U2OSN000N
PDE4DIPIHDKAVLWSBONE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58CAL78N2020N
PDE4DIPIHDKAVLWSBONE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58HS819TN2020N
PDE4DIPIHDKAVLWSBONE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58HS821TN2020N
PDE4DIPIHDKAVLWSBONE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SAOS2N2020N
PDE4DIPIHDKAVLWSBONE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58SKES1N2020N
PDE4DIPIHDKAVLWSBONE481p.V486fsc.1458_1458delTFrame_Shift_Del318.58U2OSN2020N
PDE4DIPQRIHDKAVLBONE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58CAL78N600N
PDE4DIPQRIHDKAVLBONE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58HS819TN600N
PDE4DIPQRIHDKAVLBONE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58HS821TN600N
PDE4DIPQRIHDKAVLBONE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SAOS2N600N
PDE4DIPQRIHDKAVLBONE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58SKES1N600N
PDE4DIPQRIHDKAVLBONE479p.V486fsc.1458_1458delTFrame_Shift_Del118.58U2OSN600N
PDE4DIPRIHDKAVLWBONE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58CAL78N400N
PDE4DIPRIHDKAVLWBONE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58HS819TN400N
PDE4DIPRIHDKAVLWBONE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58HS821TN400N
PDE4DIPRIHDKAVLWBONE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SAOS2N400N
PDE4DIPRIHDKAVLWBONE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58SKES1N400N
PDE4DIPRIHDKAVLWBONE480p.V486fsc.1458_1458delTFrame_Shift_Del218.58U2OSN400N
PDE4DIPAAVRHQWSPBONE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N000N
PDE4DIPAAVRHQWSPBONE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN000N
PDE4DIPAAVRHQWSPBONE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN000N
PDE4DIPAAVRHQWSPBONE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N000N
PDE4DIPAAVRHQWSPBONE1730p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN000N
PDE4DIPACQLPRIPPBONE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N000N
PDE4DIPACQLPRIPPBONE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN000N
PDE4DIPACQLPRIPPBONE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN000N
PDE4DIPACQLPRIPPBONE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N000N
PDE4DIPACQLPRIPPBONE1677p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN000N
PDE4DIPAFIFTPYPSBONE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPAFIFTPYPSBONE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPAFIFTPYPSBONE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPAFIFTPYPSBONE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPAFIFTPYPSBONE1694p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPAFLRHHCPQBONE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPAFLRHHCPQBONE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPAFLRHHCPQBONE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPAFLRHHCPQBONE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPAFLRHHCPQBONE1705p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPALFLLLPQLBONE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y16110N
PDE4DIPALFLLLPQLBONE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY16110N
PDE4DIPALFLLLPQLBONE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY16110N
PDE4DIPALFLLLPQLBONE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y16110N
PDE4DIPALFLLLPQLBONE1758p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY16110N
PDE4DIPALSSLAAVRBONE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78Y6100N
PDE4DIPALSSLAAVRBONE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TY6100N
PDE4DIPALSSLAAVRBONE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TY6100N
PDE4DIPALSSLAAVRBONE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1Y6100N
PDE4DIPALSSLAAVRBONE1725p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSY6100N
PDE4DIPAPLALSSLABONE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N1000N
PDE4DIPAPLALSSLABONE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN1000N
PDE4DIPAPLALSSLABONE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN1000N
PDE4DIPAPLALSSLABONE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N1000N
PDE4DIPAPLALSSLABONE1722p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN1000N
PDE4DIPASCLSAPLABONE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N100N
PDE4DIPASCLSAPLABONE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN100N
PDE4DIPASCLSAPLABONE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN100N
PDE4DIPASCLSAPLABONE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N100N
PDE4DIPASCLSAPLABONE1717p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN100N
PDE4DIPASRGLRPNPBONE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000Y
PDE4DIPASRGLRPNPBONE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000Y
PDE4DIPASRGLRPNPBONE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000Y
PDE4DIPASRGLRPNPBONE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000Y
PDE4DIPASRGLRPNPBONE1663p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000Y
PDE4DIPATPSACQLPBONE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPATPSACQLPBONE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPATPSACQLPBONE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPATPSACQLPBONE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPATPSACQLPBONE1673p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPAVRHQWSPWBONE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N100N
PDE4DIPAVRHQWSPWBONE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN100N
PDE4DIPAVRHQWSPWBONE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN100N
PDE4DIPAVRHQWSPWBONE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N100N
PDE4DIPAVRHQWSPWBONE1731p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN100N
PDE4DIPCCRSSWEKVBONE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPCCRSSWEKVBONE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPCCRSSWEKVBONE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPCCRSSWEKVBONE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPCCRSSWEKVBONE1748p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPCLSAPLALSBONE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPCLSAPLALSBONE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPCLSAPLALSBONE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPCLSAPLALSBONE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPCLSAPLALSBONE1719p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPCPQLHPASCBONE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N400N
PDE4DIPCPQLHPASCBONE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN400N
PDE4DIPCPQLHPASCBONE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN400N
PDE4DIPCPQLHPASCBONE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N400N
PDE4DIPCPQLHPASCBONE1711p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN400N
PDE4DIPCQLPRIPPRBONE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N600Y
PDE4DIPCQLPRIPPRBONE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN600Y
PDE4DIPCQLPRIPPRBONE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN600Y
PDE4DIPCQLPRIPPRBONE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N600Y
PDE4DIPCQLPRIPPRBONE1678p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN600Y
PDE4DIPCRSSWEKVPBONE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPCRSSWEKVPBONE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPCRSSWEKVPBONE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPCRSSWEKVPBONE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPCRSSWEKVPBONE1749p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPEKVPALFLLBONE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N800N
PDE4DIPEKVPALFLLBONE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN800N
PDE4DIPEKVPALFLLBONE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN800N
PDE4DIPEKVPALFLLBONE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N800N
PDE4DIPEKVPALFLLBONE1754p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN800N
PDE4DIPFIFTPYPSWBONE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N500N
PDE4DIPFIFTPYPSWBONE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN500N
PDE4DIPFIFTPYPSWBONE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN500N
PDE4DIPFIFTPYPSWBONE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N500N
PDE4DIPFIFTPYPSWBONE1695p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN500N
PDE4DIPFLLLPQLHCBONE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N7023N
PDE4DIPFLLLPQLHCBONE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN7023N
PDE4DIPFLLLPQLHCBONE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN7023N
PDE4DIPFLLLPQLHCBONE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N7023N
PDE4DIPFLLLPQLHCBONE1760p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN7023N
PDE4DIPFLRHHCPQLBONE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y1399N
PDE4DIPFLRHHCPQLBONE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY1399N
PDE4DIPFLRHHCPQLBONE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY1399N
PDE4DIPFLRHHCPQLBONE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y1399N
PDE4DIPFLRHHCPQLBONE1706p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY1399N
PDE4DIPFTPYPSWLABONE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N602N
PDE4DIPFTPYPSWLABONE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN602N
PDE4DIPFTPYPSWLABONE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN602N
PDE4DIPFTPYPSWLABONE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N602N
PDE4DIPFTPYPSWLABONE1697p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN602N
PDE4DIPGLRPNPTATBONE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N200N
PDE4DIPGLRPNPTATBONE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN200N
PDE4DIPGLRPNPTATBONE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN200N
PDE4DIPGLRPNPTATBONE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N200N
PDE4DIPGLRPNPTATBONE1666p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN200N
PDE4DIPHCPQLHPASBONE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPHCPQLHPASBONE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPHCPQLHPASBONE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPHCPQLHPASBONE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPHCPQLHPASBONE1710p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPHHCPQLHPABONE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N200N
PDE4DIPHHCPQLHPABONE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN200N
PDE4DIPHHCPQLHPABONE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN200N
PDE4DIPHHCPQLHPABONE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N200N
PDE4DIPHHCPQLHPABONE1709p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN200N
PDE4DIPHPASCLSAPBONE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPHPASCLSAPBONE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPHPASCLSAPBONE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPHPASCLSAPBONE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPHPASCLSAPBONE1715p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPHQWSPWLRLBONE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y14120Y
PDE4DIPHQWSPWLRLBONE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY14120Y
PDE4DIPHQWSPWLRLBONE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY14120Y
PDE4DIPHQWSPWLRLBONE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y14120Y
PDE4DIPHQWSPWLRLBONE1734p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY14120Y
PDE4DIPIFTPYPSWLBONE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N900N
PDE4DIPIFTPYPSWLBONE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN900N
PDE4DIPIFTPYPSWLBONE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN900N
PDE4DIPIFTPYPSWLBONE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N900N
PDE4DIPIFTPYPSWLBONE1696p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN900N
PDE4DIPIPPRRPTRPBONE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPIPPRRPTRPBONE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPIPPRRPTRPBONE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPIPPRRPTRPBONE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPIPPRRPTRPBONE1683p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPIQAFIFTPYBONE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N900N
PDE4DIPIQAFIFTPYBONE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN900N
PDE4DIPIQAFIFTPYBONE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN900N
PDE4DIPIQAFIFTPYBONE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N900N
PDE4DIPIQAFIFTPYBONE1692p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN900N
PDE4DIPKPSSTSASRBONE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35CAL78Y490N
PDE4DIPKPSSTSASRBONE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HS819TY490N
PDE4DIPKPSSTSASRBONE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HS821TY490N
PDE4DIPKPSSTSASRBONE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKES1Y490N
PDE4DIPKPSSTSASRBONE1657p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35U2OSY490N
PDE4DIPKVPALFLLLBONE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y1890N
PDE4DIPKVPALFLLLBONE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY1890N
PDE4DIPKVPALFLLLBONE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY1890N
PDE4DIPKVPALFLLLBONE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y1890N
PDE4DIPKVPALFLLLBONE1755p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY1890N
PDE4DIPLAAVRHQWSBONE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPLAAVRHQWSBONE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPLAAVRHQWSBONE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPLAAVRHQWSBONE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPLAAVRHQWSBONE1729p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPLAFLRHHCPBONE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N000N
PDE4DIPLAFLRHHCPBONE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN000N
PDE4DIPLAFLRHHCPBONE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN000N
PDE4DIPLAFLRHHCPBONE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N000N
PDE4DIPLAFLRHHCPBONE1704p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN000N
PDE4DIPLALSSLAAVBONE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N1000N
PDE4DIPLALSSLAAVBONE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN1000N
PDE4DIPLALSSLAAVBONE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN1000N
PDE4DIPLALSSLAAVBONE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N1000N
PDE4DIPLALSSLAAVBONE1724p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN1000N
PDE4DIPLFLLLPQLHBONE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N0032N
PDE4DIPLFLLLPQLHBONE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN0032N
PDE4DIPLFLLLPQLHBONE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN0032N
PDE4DIPLFLLLPQLHBONE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N0032N
PDE4DIPLFLLLPQLHBONE1759p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN0032N
PDE4DIPLHPASCLSABONE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N307N
PDE4DIPLHPASCLSABONE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN307N
PDE4DIPLHPASCLSABONE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN307N
PDE4DIPLHPASCLSABONE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N307N
PDE4DIPLHPASCLSABONE1714p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN307N
PDE4DIPLPRIPPRRPBONE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPLPRIPPRRPBONE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPLPRIPPRRPBONE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPLPRIPPRRPBONE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPLPRIPPRRPBONE1680p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPLRHHCPQLHBONE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N2020N
PDE4DIPLRHHCPQLHBONE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN2020N
PDE4DIPLRHHCPQLHBONE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN2020N
PDE4DIPLRHHCPQLHBONE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N2020N
PDE4DIPLRHHCPQLHBONE1707p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN2020N
PDE4DIPLRLSRSYRCBONE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N3033N
PDE4DIPLRLSRSYRCBONE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN3033N
PDE4DIPLRLSRSYRCBONE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN3033N
PDE4DIPLRLSRSYRCBONE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N3033N
PDE4DIPLRLSRSYRCBONE1740p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN3033N
PDE4DIPLRPNPTATPBONE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N1029N
PDE4DIPLRPNPTATPBONE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN1029N
PDE4DIPLRPNPTATPBONE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN1029N
PDE4DIPLRPNPTATPBONE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N1029N
PDE4DIPLRPNPTATPBONE1667p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN1029N
PDE4DIPLSAPLALSSBONE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N200N
PDE4DIPLSAPLALSSBONE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN200N
PDE4DIPLSAPLALSSBONE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN200N
PDE4DIPLSAPLALSSBONE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N200N
PDE4DIPLSAPLALSSBONE1720p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN200N
PDE4DIPLSRSYRCCRBONE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N300N
PDE4DIPLSRSYRCCRBONE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN300N
PDE4DIPLSRSYRCCRBONE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN300N
PDE4DIPLSRSYRCCRBONE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N300N
PDE4DIPLSRSYRCCRBONE1742p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN300N
PDE4DIPLSSLAAVRHBONE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPLSSLAAVRHBONE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPLSSLAAVRHBONE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPLSSLAAVRHBONE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPLSSLAAVRHBONE1726p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPNPTATPSACBONE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N400N
PDE4DIPNPTATPSACBONE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN400N
PDE4DIPNPTATPSACBONE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN400N
PDE4DIPNPTATPSACBONE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N400N
PDE4DIPNPTATPSACBONE1670p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN400N
PDE4DIPPALFLLLPQBONE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPALFLLLPQBONE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPALFLLLPQBONE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPALFLLLPQBONE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPALFLLLPQBONE1757p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPASCLSAPLBONE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N000N
PDE4DIPPASCLSAPLBONE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN000N
PDE4DIPPASCLSAPLBONE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN000N
PDE4DIPPASCLSAPLBONE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N000N
PDE4DIPPASCLSAPLBONE1716p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN000N
PDE4DIPPIQAFIFTPBONE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N000N
PDE4DIPPIQAFIFTPBONE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN000N
PDE4DIPPIQAFIFTPBONE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN000N
PDE4DIPPIQAFIFTPBONE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N000N
PDE4DIPPIQAFIFTPBONE1691p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN000N
PDE4DIPPLALSSLAABONE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N100N
PDE4DIPPLALSSLAABONE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN100N
PDE4DIPPLALSSLAABONE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN100N
PDE4DIPPLALSSLAABONE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N100N
PDE4DIPPLALSSLAABONE1723p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN100N
PDE4DIPPNPTATPSABONE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPNPTATPSABONE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPNPTATPSABONE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPNPTATPSABONE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPNPTATPSABONE1669p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPPRRPTRPIBONE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N900N
PDE4DIPPPRRPTRPIBONE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN900N
PDE4DIPPPRRPTRPIBONE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN900N
PDE4DIPPPRRPTRPIBONE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N900N
PDE4DIPPPRRPTRPIBONE1684p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN900N
PDE4DIPPQLHPASCLBONE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N200N
PDE4DIPPQLHPASCLBONE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN200N
PDE4DIPPQLHPASCLBONE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN200N
PDE4DIPPQLHPASCLBONE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N200N
PDE4DIPPQLHPASCLBONE1712p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN200N
PDE4DIPPRIPPRRPTBONE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPRIPPRRPTBONE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPRIPPRRPTBONE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPRIPPRRPTBONE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPRIPPRRPTBONE1681p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPRRPTRPIQBONE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPRRPTRPIQBONE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPRRPTRPIQBONE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPRRPTRPIQBONE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPRRPTRPIQBONE1685p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPSACQLPRIBONE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPSACQLPRIBONE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPSACQLPRIBONE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPSACQLPRIBONE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPSACQLPRIBONE1675p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPSSTSASRGBONE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35CAL78N000Y
PDE4DIPPSSTSASRGBONE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HS819TN000Y
PDE4DIPPSSTSASRGBONE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35HS821TN000Y
PDE4DIPPSSTSASRGBONE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35SKES1N000Y
PDE4DIPPSSTSASRGBONE1658p.Q1665fsc.4994_4994delAFrame_Shift_Del120.35U2OSN000Y
PDE4DIPPSWLAFLRHBONE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPSWLAFLRHBONE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPSWLAFLRHBONE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPSWLAFLRHBONE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPSWLAFLRHBONE1701p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPTATPSACQBONE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPTATPSACQBONE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPTATPSACQBONE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPTATPSACQBONE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPTATPSACQBONE1671p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPTRPIQAFIBONE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPPTRPIQAFIBONE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPPTRPIQAFIBONE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPPTRPIQAFIBONE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPPTRPIQAFIBONE1688p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPPWLRLSRSYBONE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N000N
PDE4DIPPWLRLSRSYBONE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN000N
PDE4DIPPWLRLSRSYBONE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN000N
PDE4DIPPWLRLSRSYBONE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N000N
PDE4DIPPWLRLSRSYBONE1738p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN000N
PDE4DIPPYPSWLAFLBONE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y4100N
PDE4DIPPYPSWLAFLBONE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY4100N
PDE4DIPPYPSWLAFLBONE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY4100N
PDE4DIPPYPSWLAFLBONE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y4100N
PDE4DIPPYPSWLAFLBONE1699p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY4100N
PDE4DIPQAFIFTPYPBONE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N000N
PDE4DIPQAFIFTPYPBONE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN000N
PDE4DIPQAFIFTPYPBONE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN000N
PDE4DIPQAFIFTPYPBONE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N000N
PDE4DIPQAFIFTPYPBONE1693p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN000N
PDE4DIPQLHPASCLSBONE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPQLHPASCLSBONE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPQLHPASCLSBONE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPQLHPASCLSBONE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPQLHPASCLSBONE1713p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPQLPRIPPRRBONE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N500Y
PDE4DIPQLPRIPPRRBONE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN500Y
PDE4DIPQLPRIPPRRBONE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN500Y
PDE4DIPQLPRIPPRRBONE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N500Y
PDE4DIPQLPRIPPRRBONE1679p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN500Y
PDE4DIPQWSPWLRLSBONE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPQWSPWLRLSBONE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPQWSPWLRLSBONE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPQWSPWLRLSBONE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPQWSPWLRLSBONE1735p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPRCCRSSWEKBONE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y4100N
PDE4DIPRCCRSSWEKBONE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY4100N
PDE4DIPRCCRSSWEKBONE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY4100N
PDE4DIPRCCRSSWEKBONE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y4100N
PDE4DIPRCCRSSWEKBONE1747p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY4100N
PDE4DIPRGLRPNPTABONE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N400N
PDE4DIPRGLRPNPTABONE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN400N
PDE4DIPRGLRPNPTABONE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN400N
PDE4DIPRGLRPNPTABONE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N400N
PDE4DIPRGLRPNPTABONE1665p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN400N
PDE4DIPRHHCPQLHPBONE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N000N
PDE4DIPRHHCPQLHPBONE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN000N
PDE4DIPRHHCPQLHPBONE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN000N
PDE4DIPRHHCPQLHPBONE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N000N
PDE4DIPRHHCPQLHPBONE1708p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN000N
PDE4DIPRHQWSPWLRBONE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100Y
PDE4DIPRHQWSPWLRBONE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100Y
PDE4DIPRHQWSPWLRBONE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100Y
PDE4DIPRHQWSPWLRBONE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100Y
PDE4DIPRHQWSPWLRBONE1733p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100Y
PDE4DIPRIPPRRPTRBONE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78Y790N
PDE4DIPRIPPRRPTRBONE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TY790N
PDE4DIPRIPPRRPTRBONE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TY790N
PDE4DIPRIPPRRPTRBONE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1Y790N
PDE4DIPRIPPRRPTRBONE1682p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSY790N
PDE4DIPRLSRSYRCCBONE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y290N
PDE4DIPRLSRSYRCCBONE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY290N
PDE4DIPRLSRSYRCCBONE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY290N
PDE4DIPRLSRSYRCCBONE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y290N
PDE4DIPRLSRSYRCCBONE1741p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY290N
PDE4DIPRPIQAFIFTBONE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N500N
PDE4DIPRPIQAFIFTBONE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN500N
PDE4DIPRPIQAFIFTBONE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN500N
PDE4DIPRPIQAFIFTBONE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N500N
PDE4DIPRPIQAFIFTBONE1690p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN500N
PDE4DIPRPNPTATPSBONE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N300N
PDE4DIPRPNPTATPSBONE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN300N
PDE4DIPRPNPTATPSBONE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN300N
PDE4DIPRPNPTATPSBONE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N300N
PDE4DIPRPNPTATPSBONE1668p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN300N
PDE4DIPRPTRPIQAFBONE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y12100N
PDE4DIPRPTRPIQAFBONE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY12100N
PDE4DIPRPTRPIQAFBONE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY12100N
PDE4DIPRPTRPIQAFBONE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y12100N
PDE4DIPRPTRPIQAFBONE1687p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY12100N
PDE4DIPRRPTRPIQABONE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N500N
PDE4DIPRRPTRPIQABONE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN500N
PDE4DIPRRPTRPIQABONE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN500N
PDE4DIPRRPTRPIQABONE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N500N
PDE4DIPRRPTRPIQABONE1686p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN500N
PDE4DIPRSSWEKVPABONE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N200N
PDE4DIPRSSWEKVPABONE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN200N
PDE4DIPRSSWEKVPABONE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN200N
PDE4DIPRSSWEKVPABONE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N200N
PDE4DIPRSSWEKVPABONE1750p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN200N
PDE4DIPRSYRCCRSSBONE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100N
PDE4DIPRSYRCCRSSBONE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100N
PDE4DIPRSYRCCRSSBONE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100N
PDE4DIPRSYRCCRSSBONE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100N
PDE4DIPRSYRCCRSSBONE1744p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100N
PDE4DIPSACQLPRIPBONE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPSACQLPRIPBONE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPSACQLPRIPBONE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPSACQLPRIPBONE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPSACQLPRIPBONE1676p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPSAPLALSSLBONE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y15100N
PDE4DIPSAPLALSSLBONE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY15100N
PDE4DIPSAPLALSSLBONE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY15100N
PDE4DIPSAPLALSSLBONE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y15100N
PDE4DIPSAPLALSSLBONE1721p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY15100N
PDE4DIPSASRGLRPNBONE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N100Y
PDE4DIPSASRGLRPNBONE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN100Y
PDE4DIPSASRGLRPNBONE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN100Y
PDE4DIPSASRGLRPNBONE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N100Y
PDE4DIPSASRGLRPNBONE1662p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN100Y
PDE4DIPSCLSAPLALBONE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N1000N
PDE4DIPSCLSAPLALBONE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN1000N
PDE4DIPSCLSAPLALBONE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN1000N
PDE4DIPSCLSAPLALBONE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N1000N
PDE4DIPSCLSAPLALBONE1718p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN1000N
PDE4DIPSLAAVRHQWBONE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N300N
PDE4DIPSLAAVRHQWBONE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN300N
PDE4DIPSLAAVRHQWBONE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN300N
PDE4DIPSLAAVRHQWBONE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N300N
PDE4DIPSLAAVRHQWBONE1728p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN300N
PDE4DIPSPWLRLSRSBONE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N500Y
PDE4DIPSPWLRLSRSBONE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN500Y
PDE4DIPSPWLRLSRSBONE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN500Y
PDE4DIPSPWLRLSRSBONE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N500Y
PDE4DIPSPWLRLSRSBONE1737p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN500Y
PDE4DIPSRGLRPNPTBONE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N300Y
PDE4DIPSRGLRPNPTBONE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN300Y
PDE4DIPSRGLRPNPTBONE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN300Y
PDE4DIPSRGLRPNPTBONE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N300Y
PDE4DIPSRGLRPNPTBONE1664p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN300Y
PDE4DIPSRSYRCCRSBONE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N300N
PDE4DIPSRSYRCCRSBONE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN300N
PDE4DIPSRSYRCCRSBONE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN300N
PDE4DIPSRSYRCCRSBONE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N300N
PDE4DIPSRSYRCCRSBONE1743p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN300N
PDE4DIPSSLAAVRHQBONE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N000Y
PDE4DIPSSLAAVRHQBONE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN000Y
PDE4DIPSSLAAVRHQBONE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN000Y
PDE4DIPSSLAAVRHQBONE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N000Y
PDE4DIPSSLAAVRHQBONE1727p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN000Y
PDE4DIPSSTSASRGLBONE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35CAL78N700N
PDE4DIPSSTSASRGLBONE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35HS819TN700N
PDE4DIPSSTSASRGLBONE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35HS821TN700N
PDE4DIPSSTSASRGLBONE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35SKES1N700N
PDE4DIPSSTSASRGLBONE1659p.Q1665fsc.4994_4994delAFrame_Shift_Del220.35U2OSN700N
PDE4DIPSSWEKVPALBONE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y1990N
PDE4DIPSSWEKVPALBONE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY1990N
PDE4DIPSSWEKVPALBONE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY1990N
PDE4DIPSSWEKVPALBONE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y1990N
PDE4DIPSSWEKVPALBONE1751p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY1990N
PDE4DIPSTSASRGLRBONE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35CAL78N400N
PDE4DIPSTSASRGLRBONE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35HS819TN400N
PDE4DIPSTSASRGLRBONE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35HS821TN400N
PDE4DIPSTSASRGLRBONE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35SKES1N400N
PDE4DIPSTSASRGLRBONE1660p.Q1665fsc.4994_4994delAFrame_Shift_Del320.35U2OSN400N
PDE4DIPSWEKVPALFBONE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N300N
PDE4DIPSWEKVPALFBONE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN300N
PDE4DIPSWEKVPALFBONE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN300N
PDE4DIPSWEKVPALFBONE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N300N
PDE4DIPSWEKVPALFBONE1752p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN300N
PDE4DIPSWLAFLRHHBONE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N000N
PDE4DIPSWLAFLRHHBONE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN000N
PDE4DIPSWLAFLRHHBONE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN000N
PDE4DIPSWLAFLRHHBONE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N000N
PDE4DIPSWLAFLRHHBONE1702p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN000N
PDE4DIPSYRCCRSSWBONE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78Y2100N
PDE4DIPSYRCCRSSWBONE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TY2100N
PDE4DIPSYRCCRSSWBONE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TY2100N
PDE4DIPSYRCCRSSWBONE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1Y2100N
PDE4DIPSYRCCRSSWBONE1745p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSY2100N
PDE4DIPTATPSACQLBONE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N1100N
PDE4DIPTATPSACQLBONE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN1100N
PDE4DIPTATPSACQLBONE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN1100N
PDE4DIPTATPSACQLBONE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N1100N
PDE4DIPTATPSACQLBONE1672p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN1100N
PDE4DIPTPSACQLPRBONE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N500N
PDE4DIPTPSACQLPRBONE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN500N
PDE4DIPTPSACQLPRBONE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN500N
PDE4DIPTPSACQLPRBONE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N500N
PDE4DIPTPSACQLPRBONE1674p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN500N
PDE4DIPTPYPSWLAFBONE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78Y19100N
PDE4DIPTPYPSWLAFBONE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TY19100N
PDE4DIPTPYPSWLAFBONE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TY19100N
PDE4DIPTPYPSWLAFBONE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1Y19100N
PDE4DIPTPYPSWLAFBONE1698p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSY19100N
PDE4DIPTRPIQAFIFBONE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N400N
PDE4DIPTRPIQAFIFBONE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN400N
PDE4DIPTRPIQAFIFBONE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN400N
PDE4DIPTRPIQAFIFBONE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N400N
PDE4DIPTRPIQAFIFBONE1689p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN400N
PDE4DIPTSASRGLRPBONE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N000N
PDE4DIPTSASRGLRPBONE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN000N
PDE4DIPTSASRGLRPBONE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN000N
PDE4DIPTSASRGLRPBONE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N000N
PDE4DIPTSASRGLRPBONE1661p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN000N
PDE4DIPVPALFLLLPBONE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N200N
PDE4DIPVPALFLLLPBONE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN200N
PDE4DIPVPALFLLLPBONE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN200N
PDE4DIPVPALFLLLPBONE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N200N
PDE4DIPVPALFLLLPBONE1756p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN200N
PDE4DIPVRHQWSPWLBONE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78N905Y
PDE4DIPVRHQWSPWLBONE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TN905Y
PDE4DIPVRHQWSPWLBONE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TN905Y
PDE4DIPVRHQWSPWLBONE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1N905Y
PDE4DIPVRHQWSPWLBONE1732p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSN905Y
PDE4DIPWEKVPALFLBONE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78Y12125N
PDE4DIPWEKVPALFLBONE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TY12125N
PDE4DIPWEKVPALFLBONE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TY12125N
PDE4DIPWEKVPALFLBONE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1Y12125N
PDE4DIPWEKVPALFLBONE1753p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSY12125N
PDE4DIPWLAFLRHHCBONE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35CAL78Y41017N
PDE4DIPWLAFLRHHCBONE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS819TY41017N
PDE4DIPWLAFLRHHCBONE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35HS821TY41017N
PDE4DIPWLAFLRHHCBONE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35SKES1Y41017N
PDE4DIPWLAFLRHHCBONE1703p.Q1665fsc.4994_4994delAFrame_Shift_Del620.35U2OSY41017N
PDE4DIPWLRLSRSYRBONE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78Y71012N
PDE4DIPWLRLSRSYRBONE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TY71012N
PDE4DIPWLRLSRSYRBONE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TY71012N
PDE4DIPWLRLSRSYRBONE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1Y71012N
PDE4DIPWLRLSRSYRBONE1739p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSY71012N
PDE4DIPWSPWLRLSRBONE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35CAL78N605Y
PDE4DIPWSPWLRLSRBONE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS819TN605Y
PDE4DIPWSPWLRLSRBONE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35HS821TN605Y
PDE4DIPWSPWLRLSRBONE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35SKES1N605Y
PDE4DIPWSPWLRLSRBONE1736p.Q1665fsc.4994_4994delAFrame_Shift_Del420.35U2OSN605Y
PDE4DIPYPSWLAFLRBONE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N702N
PDE4DIPYPSWLAFLRBONE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN702N
PDE4DIPYPSWLAFLRBONE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN702N
PDE4DIPYPSWLAFLRBONE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N702N
PDE4DIPYPSWLAFLRBONE1700p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN702N
PDE4DIPYRCCRSSWEBONE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35CAL78N305N
PDE4DIPYRCCRSSWEBONE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS819TN305N
PDE4DIPYRCCRSSWEBONE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35HS821TN305N
PDE4DIPYRCCRSSWEBONE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35SKES1N305N
PDE4DIPYRCCRSSWEBONE1746p.Q1665fsc.4994_4994delAFrame_Shift_Del520.35U2OSN305N
PDE4DIPAFYSPGLEABONE1426p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353Y390N
PDE4DIPEAKKDLESLBONE1433p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N900N
PDE4DIPFYSPGLEAKBONE1427p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353Y2140N
PDE4DIPGAFYSPGLEBONE1425p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N000N
PDE4DIPGLEAKKDLEBONE1431p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N000N
PDE4DIPLEAKKDLESBONE1432p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N400N
PDE4DIPPGLEAKKDLBONE1430p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N000N
PDE4DIPSPGLEAKKDBONE1429p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N000N
PDE4DIPYSPGLEAKKBONE1428p.Q1433Ec.4297C>GMissense_Mutation10.11SW1353N300N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23CAL78N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS706TN000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS737TN000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS819TN000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS821TN000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS863TN000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23HS888TN000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23MG63N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23MHHES1N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23OUMS27N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23SAOS2N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23SKES1N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23SW1353N000N
PIK3C2GCSWGSIGKHBONE124p.P129delc.384_386delCCCIn_Frame_Del447.23U2OSN000N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23CAL78N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS706TN100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS737TN100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS819TN100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS821TN100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS863TN100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23HS888TN100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23MG63N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23MHHES1N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23OUMS27N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23SAOS2N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23SKES1N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23SW1353N100N
PIK3C2GECSWGSIGKBONE123p.P129delc.384_386delCCCIn_Frame_Del347.23U2OSN100N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23CAL78N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS706TN300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS737TN300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS819TN300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS821TN300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS863TN300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23HS888TN300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23MG63N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23MHHES1N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23OUMS27N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23SAOS2N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23SKES1N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23SW1353N300N
PIK3C2GGSIGKHHGABONE127p.P129delc.384_386delCCCIn_Frame_Del247.23U2OSN300N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23CAL78N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS706TN000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS737TN000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS819TN000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS821TN000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS863TN000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23HS888TN000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23MG63N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23MHHES1N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23OUMS27N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23SAOS2N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23SKES1N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23SW1353N000N
PIK3C2GKECSWGSIGBONE122p.P129delc.384_386delCCCIn_Frame_Del247.23U2OSN000N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23CAL78N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS706TN100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS737TN100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS819TN100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS821TN100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS863TN100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23HS888TN100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23MG63N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23MHHES1N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23OUMS27N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23SAOS2N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23SKES1N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23SW1353N100N
PIK3C2GNKECSWGSIBONE121p.P129delc.384_386delCCCIn_Frame_Del147.23U2OSN100N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23CAL78N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS706TN000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS737TN000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS819TN000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS821TN000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS863TN000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23HS888TN000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23MG63N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23MHHES1N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23OUMS27N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23SAOS2N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23SKES1N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23SW1353N000N
PIK3C2GSIGKHHGADBONE128p.P129delc.384_386delCCCIn_Frame_Del147.23U2OSN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23CAL78N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS706TN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS737TN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS819TN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS821TN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS863TN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23HS888TN000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23MG63N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23MHHES1N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23OUMS27N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23SAOS2N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23SKES1N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23SW1353N000N
PIK3C2GSWGSIGKHHBONE125p.P129delc.384_386delCCCIn_Frame_Del447.23U2OSN000N
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23CAL78N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS706TN107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS737TN107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS819TN107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS821TN107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS863TN107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23HS888TN107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23MG63N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23MHHES1N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23OUMS27N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23SAOS2N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23SKES1N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23SW1353N107Y
PIK3C2GWGSIGKHHGBONE126p.P129delc.384_386delCCCIn_Frame_Del347.23U2OSN107Y
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N000N
PRKDCAGHAMLAGPBONE1251p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N000N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N100N
PRKDCAGPAPGRVGBONE1257p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N100N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCY290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173Y290N
PRKDCAIQPAGHAMBONE1247p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71Y290N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N000N
PRKDCAMLAGPAPGBONE1254p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N000N
PRKDCAPGRVGVLQBONE1260p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N000N
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48A673N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CADOES1N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48CAL78N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS706TN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS819TN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS821TN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS822TN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS863TN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48HS888TN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48MG63N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48MHHES1N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48OUMS27N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SJSA1N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKES1N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SKNMCN000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48SW1353N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48T173N000Y
PRKDCAQPTLLYPSBONE1237p.L1244fsc.3730_3731insCFrame_Shift_Ins292.48TC71N000Y
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N300N
PRKDCCRSAPGPRYBONE1276p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N300N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48A673N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CADOES1N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CAL78N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS706TN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS819TN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS821TN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS822TN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS863TN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS888TN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MG63N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MHHES1N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48OUMS27N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SJSA1N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKES1N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNMCN000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SW1353N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48T173N000N
PRKDCENCRSAPGPBONE1274p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TC71N000N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N400N
PRKDCGAIQPAGHABONE1246p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N400N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N100N
PRKDCGHAMLAGPABONE1252p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N100N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCY13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173Y13150N
PRKDCGPAPGRVGVBONE1258p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71Y13150N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCY490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173Y490N
PRKDCGRVGVLQHVBONE1262p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71Y490N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCY690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173Y690N
PRKDCGVLQHVHWRBONE1265p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71Y690N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N000N
PRKDCHAMLAGPAPBONE1253p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N000N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48A673Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CADOES1Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CAL78Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS706TY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS819TY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS821TY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS822TY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS863TY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS888TY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MG63Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MHHES1Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48OUMS27Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SJSA1Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKES1Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNMCY690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SW1353Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48T173Y690N
PRKDCHVHWRENCRBONE1269p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TC71Y690N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48A673N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CADOES1N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48CAL78N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS706TN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS819TN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS821TN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS822TN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS863TN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48HS888TN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MG63N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48MHHES1N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48OUMS27N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SJSA1N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKES1N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SKNMCN100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48SW1353N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48T173N100N
PRKDCHWRENCRSABONE1271p.L1244fsc.3730_3731insCFrame_Shift_Ins692.48TC71N100N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N1400N
PRKDCIQPAGHAMLBONE1248p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N1400N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48A673N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CADOES1N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48CAL78N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS706TN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS819TN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS821TN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS822TN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS863TN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48HS888TN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MG63N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48MHHES1N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48OUMS27N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SJSA1N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKES1N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SKNMCN500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48SW1353N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48T173N500N
PRKDCLAGPAPGRVBONE1256p.L1244fsc.3730_3731insCFrame_Shift_Ins492.48TC71N500N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48A673N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48CADOES1N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48CAL78N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS706TN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS819TN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS821TN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS822TN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS863TN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48HS888TN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48MG63N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48MHHES1N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48OUMS27N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SJSA1N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKES1N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SKNMCN000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48SW1353N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48T173N000N
PRKDCLAQPTLLYPBONE1236p.L1244fsc.3730_3731insCFrame_Shift_Ins192.48TC71N000N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N100N
PRKDCLLYPSGAIQBONE1241p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N100N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N000N
PRKDCLQHVHWRENBONE1267p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N000N
PRKDCLYPSGAIQPBONE1242p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N000N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N500N
PRKDCMLAGPAPGRBONE1255p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N500N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKES1N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SKNMCN300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SW1353N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48T173N300N
PRKDCNCRSAPGPRBONE1275p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48TC71N300N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48A673N000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CADOES1N000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48CAL78N000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS706TN000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS819TN000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS821TN000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS822TN000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS863TN000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48HS888TN000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MG63N000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48MHHES1N000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48OUMS27N000N
PRKDCPAGHAMLAGBONE1250p.L1244fsc.3730_3731insCFrame_Shift_Ins592.48SJSA1