Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for CAP are 1
Results from 0 - 25
siRNA sequence "aacaaacaaacagcgaugaa" alignment with "West Nile Virus [WNV]" virus reference Genome sequences
siRNA sequence matching with "aacaaacaaacagcgaugaa" West Nile Virus [WNV]" Virus reference Genome sequences
Browse all the records for "West Nile Virus [WNV]" virus
Browse "virsi2145 " record
Length: 20
GC Content:35 %
GenBank Acc: NC_001563
Transfection Reagent: TransIT-LT1
Length: 20
GC Content:35 %
GenBank Acc: NC_001563
Transfection Reagent: TransIT-LT1
Offtargets for "aacaaacaaacagcgaugaa" siRNA in Human Genome sequences
See NC_001563 at Genbank
Pubmed:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218
Article:The utility of siRNA transcripts produced by RNA polymerase i in down regulating viral gene expression and replication of negative- and positive-strand RNA viruses.
Authors:McCown M, Diamond MS, Pekosz A.
Journal:Virology. 2003 Sep 1;313(2):514-24.
Entrez:12954218
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2145 | aacaaacaaacagcgaugaa | West Nile Virus [WNV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm