Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for LMP1 are 10
Results from 0 - 25
siRNA sequence "aacugguggacucuauugg" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aacugguggacucuauugg" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1857 " record
Length: 19
GC Content:47 %
Starting position: 1044
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Length: 19
GC Content:47 %
Starting position: 1044
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Offtargets for "aacugguggacucuauugg" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15013447
Article:Suppression of Epstein-Barr virus-encoded latent membrane protein-1 by RNA interference inhibits the metastatic potential of nasopharyngeal carcinoma cells.
Authors:Li XP, Li G, Peng Y, Kung HF, Lin MC.
Journal:Biochem Biophys Res Commun. 2004 Feb 27;315(1):212-8.
Entrez:15013447
Article:Suppression of Epstein-Barr virus-encoded latent membrane protein-1 by RNA interference inhibits the metastatic potential of nasopharyngeal carcinoma cells.
Authors:Li XP, Li G, Peng Y, Kung HF, Lin MC.
Journal:Biochem Biophys Res Commun. 2004 Feb 27;315(1):212-8.
Entrez:15013447
siRNA sequence "ggaauuugcacggacaggc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ggaauuugcacggacaggc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1856 " record
Length: 19
GC Content:58 %
Starting position: 773
GenBank Acc: EU910134
Transfection Reagent: Lipofectamine 2000
Length: 19
GC Content:58 %
Starting position: 773
GenBank Acc: EU910134
Transfection Reagent: Lipofectamine 2000
Offtargets for "ggaauuugcacggacaggc" siRNA in Human Genome sequences
See EU910134 at Genbank
Pubmed:16458115
Article:siRNA targeting LMP1-induced apoptosis in EBV-positive lymphoma cells is associated with inhibition of telomerase activity and expression.
Authors:Mei YP, Zhu XF, Zhou JM, Huang H, Deng R, Zeng YX.
Journal:Cancer Lett. 2006 Feb 8;232(2):189-98.
Entrez:16458115
Article:siRNA targeting LMP1-induced apoptosis in EBV-positive lymphoma cells is associated with inhibition of telomerase activity and expression.
Authors:Mei YP, Zhu XF, Zhou JM, Huang H, Deng R, Zeng YX.
Journal:Cancer Lett. 2006 Feb 8;232(2):189-98.
Entrez:16458115
siRNA sequence "gccuguccgugcaaauucc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "gccuguccgugcaaauucc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1885 " record
Length: 19
GC Content:58 %
Starting position: 371
Strain of Virus: EBV
GenBank Acc: EU000388
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:58 %
Starting position: 371
Strain of Virus: EBV
GenBank Acc: EU000388
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gccuguccgugcaaauucc" siRNA in Human Genome sequences
See EU000388 at Genbank
Pubmed:20338061
Article:Epstein-Barr virus encoded latent membrane protein 1 regulates mTOR signaling pathway genes which predict poor prognosis of nasopharyngeal carcinoma.
Authors:Chen J, Hu CF, Hou JH, Shao Q, Yan LX, Zhu XF, Zeng YX, Shao JY.
Journal:J Transl Med. 2010 Mar 26;8:30.
Entrez:20338061
Article:Epstein-Barr virus encoded latent membrane protein 1 regulates mTOR signaling pathway genes which predict poor prognosis of nasopharyngeal carcinoma.
Authors:Chen J, Hu CF, Hou JH, Shao Q, Yan LX, Zhu XF, Zeng YX, Shao JY.
Journal:J Transl Med. 2010 Mar 26;8:30.
Entrez:20338061
siRNA sequence "ccucuccucuuccauaggc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccucuccucuuccauaggc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1860 " record
Length: 19
GC Content:58 %
Starting position: 612
GenBank Acc: X66863
Incubation Time (Hours):60
Length: 19
GC Content:58 %
Starting position: 612
GenBank Acc: X66863
Incubation Time (Hours):60
Offtargets for "ccucuccucuuccauaggc" siRNA in Human Genome sequences
See X66863 at Genbank
Pubmed:16865275
Article:Recombinant adeno-associated virus mediated RNA interference inhibits metastasis of nasopharyngeal cancer cells in vivo and in vitro by suppression of Epstein-Barr virus encoded LMP-1.
Authors:Li X, Liu X, Li CY, Ding Y, Chau D, Li G, Kung HF, Lin MC, Peng Y.
Journal:Int J Oncol. 2006 Sep;29(3):595-603.
Entrez:16865275
Article:Recombinant adeno-associated virus mediated RNA interference inhibits metastasis of nasopharyngeal cancer cells in vivo and in vitro by suppression of Epstein-Barr virus encoded LMP-1.
Authors:Li X, Liu X, Li CY, Ding Y, Chau D, Li G, Kung HF, Lin MC, Peng Y.
Journal:Int J Oncol. 2006 Sep;29(3):595-603.
Entrez:16865275
siRNA sequence "guggacagagaaggucucu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "guggacagagaaggucucu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1850 " record
Length: 19
GC Content:53 %
Starting position: 622
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36
Length: 19
GC Content:53 %
Starting position: 622
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36
Offtargets for "guggacagagaaggucucu" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
siRNA sequence "ccaauagaguccaccaguu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ccaauagaguccaccaguu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1849 " record
Length: 19
GC Content:47 %
Starting position: 1044
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:47 %
Starting position: 1044
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "ccaauagaguccaccaguu" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
siRNA sequence "ggaauuugcacggacaggc" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "ggaauuugcacggacaggc" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1858 " record
Length: 19
GC Content:58 %
Starting position: 773
GenBank Acc: EU910134
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:58 %
Starting position: 773
GenBank Acc: EU910134
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ggaauuugcacggacaggc" siRNA in Human Genome sequences
See EU910134 at Genbank
Pubmed:17507800
Article:Silencing of LMP1 induces cell cycle arrest and enhances chemosensitivity through inhibition of AKT signaling pathway in EBV-positive nasopharyngeal carcinoma cells.
Authors:Mei YP, Zhou JM, Wang Y, Huang H, Deng R, Feng GK, Zeng YX, Zhu XF.
Journal:Cell Cycle. 2007 Jun 1;6(11):1379-85. Epub 2007 Jun 11.
Entrez:17507800
Article:Silencing of LMP1 induces cell cycle arrest and enhances chemosensitivity through inhibition of AKT signaling pathway in EBV-positive nasopharyngeal carcinoma cells.
Authors:Mei YP, Zhou JM, Wang Y, Huang H, Deng R, Feng GK, Zeng YX, Zhu XF.
Journal:Cell Cycle. 2007 Jun 1;6(11):1379-85. Epub 2007 Jun 11.
Entrez:17507800
siRNA sequence "aagagaccuucucuguccacu" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aagagaccuucucuguccacu" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1883 " record
Length: 21
GC Content:48 %
Starting position: 291
Strain of Virus: EBV
GenBank Acc: NC_007605
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 291
Strain of Virus: EBV
GenBank Acc: NC_007605
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "aagagaccuucucuguccacu" siRNA in Human Genome sequences
See NC_007605 at Genbank
Pubmed:18230756
Article:EBV LMP2A affects LMP1-mediated NF-kappaB signaling and survival of lymphoma cells by regulating TRAF2 expression.
Authors:Guasparri I, Bubman D, Cesarman E.
Journal:Blood. 2008 Apr 1;111(7):3813-20. Epub 2008 Jan 29. Erratum in: Blood. 2008 Jul 15;112(2):452.
Entrez:18230756
Article:EBV LMP2A affects LMP1-mediated NF-kappaB signaling and survival of lymphoma cells by regulating TRAF2 expression.
Authors:Guasparri I, Bubman D, Cesarman E.
Journal:Blood. 2008 Apr 1;111(7):3813-20. Epub 2008 Jan 29. Erratum in: Blood. 2008 Jul 15;112(2):452.
Entrez:18230756
siRNA sequence "aaugccuguccuugcaaau" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "aaugccuguccuugcaaau" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1851 " record
Length: 19
GC Content:42 %
Starting position: 776
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36
Length: 19
GC Content:42 %
Starting position: 776
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36
Offtargets for "aaugccuguccuugcaaau" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
siRNA sequence "agaaggagagcuaggccua" alignment with "Epstein-Barr Virus [EBV]" virus reference Genome sequences
siRNA sequence matching with "agaaggagagcuaggccua" Epstein-Barr Virus [EBV]" Virus reference Genome sequences
Browse all the records for "Epstein-Barr Virus [EBV]" virus
Browse "virsi1852 " record
Length: 19
GC Content:53 %
Starting position: 476
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36
Length: 19
GC Content:53 %
Starting position: 476
GenBank Acc: EU910136
Transfection Reagent: Oligofectamine
Incubation Time (Hours):36
Offtargets for "agaaggagagcuaggccua" siRNA in Human Genome sequences
See EU910136 at Genbank
Pubmed:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
Article:Effect of inhibition of EBV-encoded latent membrane protein-1 by small interfering RNA on EBV-positive nasopharyngeal carcinoma cell growth.
Authors:Li G, Li XP, Peng Y, Liu X, Li XH.
Journal:Di Yi Jun Yi Da Xue Xue Bao. 2004 Mar;24(3):241-6.
Entrez:15041532
Virus_Name
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm