Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for NS5A are 4
Results from 0 - 25
siRNA sequence "ugcacgguguugacugauuuc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ugcacgguguugacugauuuc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1984 " record
Length: 21
GC Content:48 %
Starting position: 4690
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 4690
Strain of Virus: Genotype 1b
GenBank Acc: AJ242654
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48
Offtargets for "ugcacgguguugacugauuuc" siRNA in Human Genome sequences
See AJ242654 at Genbank
Pubmed:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
Article:The efficacy of siRNAs against hepatitis C virus is strongly influenced by structure and target site accessibility.
Authors:Sagan SM, Nasheri N, Luebbert C, Pezacki JP.
Journal:Chem Biol. 2010 May 28;17(5):515-27.
Entrez:20534349
siRNA sequence "acgggacgaugaggaucuu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "acgggacgaugaggaucuu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2165 " record
Length: 19
GC Content:53 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000 / siPORT
Incubation Time (Hours):48
Length: 19
GC Content:53 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000 / siPORT
Incubation Time (Hours):48
Offtargets for "acgggacgaugaggaucuu" siRNA in Human Genome sequences
See NC_004102 at Genbank
Pubmed:12951263
Article:Inhibition of hepatitis C virus protein expression by RNA interference.
Authors:Sen A, Steele R, Ghosh AK, Basu A, Ray R, Ray RB.
Journal:Virus Res. 2003 Oct;96(1-2):27-35.
Entrez:12951263
Article:Inhibition of hepatitis C virus protein expression by RNA interference.
Authors:Sen A, Steele R, Ghosh AK, Basu A, Ray R, Ray RB.
Journal:Virus Res. 2003 Oct;96(1-2):27-35.
Entrez:12951263
siRNA sequence "gcuuuggcagcuccucauu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gcuuuggcagcuccucauu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2166 " record
Length: 19
GC Content:53 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000 / siPORT
Incubation Time (Hours):48
Length: 19
GC Content:53 %
GenBank Acc: NC_004102
Transfection Reagent: Lipofectamine 2000 / siPORT
Incubation Time (Hours):48
Offtargets for "gcuuuggcagcuccucauu" siRNA in Human Genome sequences
See NC_004102 at Genbank
Pubmed:12951263
Article:Inhibition of hepatitis C virus protein expression by RNA interference.
Authors:Sen A, Steele R, Ghosh AK, Basu A, Ray R, Ray RB.
Journal:Virus Res. 2003 Oct;96(1-2):27-35.
Entrez:12951263
Article:Inhibition of hepatitis C virus protein expression by RNA interference.
Authors:Sen A, Steele R, Ghosh AK, Basu A, Ray R, Ray RB.
Journal:Virus Res. 2003 Oct;96(1-2):27-35.
Entrez:12951263
siRNA sequence "aaccucaaagaaaaaccaaag" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi3007 " record
Length: 21
GC Content:33 %
Starting position: 358
GenBank Acc: FN675942
Transfection Reagent: Oligofectamine
Length: 21
GC Content:33 %
Starting position: 358
GenBank Acc: FN675942
Transfection Reagent: Oligofectamine
Offtargets for "aaccucaaagaaaaaccaaag" siRNA in Human Genome sequences
See FN675942 at Genbank
Pubmed:17052275
Article:siRNA-resistance in treated HCV replicon cells is correlated with the development of specific HCV mutations.
Authors:Konishi M, Wu CH, Kaito M, Hayashi K, Watanabe S, Adachi Y, Wu GY.
Journal:J Viral Hepat. 2006 Nov;13(11):756-61.
Entrez:17052275
Article:siRNA-resistance in treated HCV replicon cells is correlated with the development of specific HCV mutations.
Authors:Konishi M, Wu CH, Kaito M, Hayashi K, Watanabe S, Adachi Y, Wu GY.
Journal:J Viral Hepat. 2006 Nov;13(11):756-61.
Entrez:17052275
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1984 | ugcacgguguugacugauuuc | Hepatitis C Virus [HCV] |  SL | refseqs |  | |||||
| virsi2165 | acgggacgaugaggaucuu | Hepatitis C Virus [HCV] | SL | refseqs |  | |||||
| virsi2166 | gcuuuggcagcuccucauu | Hepatitis C Virus [HCV] |  SL | refseqs |  | |||||
| virsi3007 | aaccucaaagaaaaaccaaag | Hepatitis C Virus [HCV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm