Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for RdRp are 10
Results from 0 - 25
siRNA sequence "cuaaggaccuaacaaaguu" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "cuaaggaccuaacaaaguu" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi1835 " record
Length: 19
GC Content:37 %
Starting position: 6314
Strain of Virus: B3
GenBank Acc: M33854
Transfection Reagent: Lipofectamine 2000
Length: 19
GC Content:37 %
Starting position: 6314
Strain of Virus: B3
GenBank Acc: M33854
Transfection Reagent: Lipofectamine 2000
Offtargets for "cuaaggaccuaacaaaguu" siRNA in Human Genome sequences
See M33854 at Genbank
Pubmed:17112603
Article:Strand-specific silencing of a picornavirus by RNA interference: evidence for the superiority of plus-strand specific siRNAs.
Authors:Schubert S, Rothe D, Werk D, Grunert HP, Zeichhardt H, Erdmann VA, Kurreck J.
Journal:Antiviral Res. 2007 Mar;73(3):197-205. Epub 2006 Nov 2.
Entrez:17112603
Article:Strand-specific silencing of a picornavirus by RNA interference: evidence for the superiority of plus-strand specific siRNAs.
Authors:Schubert S, Rothe D, Werk D, Grunert HP, Zeichhardt H, Erdmann VA, Kurreck J.
Journal:Antiviral Res. 2007 Mar;73(3):197-205. Epub 2006 Nov 2.
Entrez:17112603
siRNA sequence "guuuacaacuggugagaca" alignment with "Hepatitis E Virus [HEV]" virus reference Genome sequences
siRNA sequence matching with "guuuacaacuggugagaca" Hepatitis E Virus [HEV]" Virus reference Genome sequences
Browse all the records for "Hepatitis E Virus [HEV]" virus
Browse "virsi2189 " record
Length: 19
GC Content:42 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "guuuacaacuggugagaca" siRNA in Human Genome sequences
See AY594199 at Genbank
Pubmed:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
siRNA sequence "cgugaugugucucggauaa" alignment with "Hepatitis E Virus [HEV]" virus reference Genome sequences
siRNA sequence matching with "cgugaugugucucggauaa" Hepatitis E Virus [HEV]" Virus reference Genome sequences
Browse all the records for "Hepatitis E Virus [HEV]" virus
Browse "virsi2188 " record
Length: 19
GC Content:47 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:47 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "cgugaugugucucggauaa" siRNA in Human Genome sequences
See AY594199 at Genbank
Pubmed:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
siRNA sequence "ggguuagaguguauaauca" alignment with "Hepatitis E Virus [HEV]" virus reference Genome sequences
siRNA sequence matching with "ggguuagaguguauaauca" Hepatitis E Virus [HEV]" Virus reference Genome sequences
Browse all the records for "Hepatitis E Virus [HEV]" virus
Browse "virsi2190 " record
Length: 19
GC Content:37 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:37 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ggguuagaguguauaauca" siRNA in Human Genome sequences
See AY594199 at Genbank
Pubmed:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
siRNA sequence "guuccgugcuauugagaaa" alignment with "Hepatitis E Virus [HEV]" virus reference Genome sequences
siRNA sequence matching with "guuccgugcuauugagaaa" Hepatitis E Virus [HEV]" Virus reference Genome sequences
Browse all the records for "Hepatitis E Virus [HEV]" virus
Browse "virsi2187 " record
Length: 19
GC Content:42 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Strain of Virus: 4
GenBank Acc: AY594199
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "guuccgugcuauugagaaa" siRNA in Human Genome sequences
See AY594199 at Genbank
Pubmed:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
Article:Effective inhibition of hepatitis E virus replication in A549 cells and piglets by RNA interference (RNAi) targeting RNA-dependent RNA polymerase.
Authors:Huang F, Hua X, Yang S, Yuan C, Zhang W.
Journal:Antiviral Res. 2009 Sep;83(3):274-81. Epub 2009 Jul 1.
Entrez:19576249
siRNA sequence "aaggacaugaccuaccguagac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaggacaugaccuaccguagac" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1292 " record
Length: 22
GC Content:50 %
Starting position: 392
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 22
GC Content:50 %
Starting position: 392
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aaggacaugaccuaccguagac" siRNA in Human Genome sequences
See AY268070 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
siRNA sequence "aaugucaaccgcuucaauguggc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaugucaaccgcuucaauguggc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1296 " record
Length: 23
GC Content:48 %
Starting position: 119
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 23
GC Content:48 %
Starting position: 119
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aaugucaaccgcuucaauguggc" siRNA in Human Genome sequences
See AY268070 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
siRNA sequence "guacagggauaaacauuac" alignment with "Human Coxsackievirus [CV]" virus reference Genome sequences
siRNA sequence matching with "guacagggauaaacauuac" Human Coxsackievirus [CV]" Virus reference Genome sequences
Browse all the records for "Human Coxsackievirus [CV]" virus
Browse "virsi1834 " record
Length: 19
GC Content:37 %
Starting position: 6735
Strain of Virus: B3
Incubation Time (Hours):72
Length: 19
GC Content:37 %
Starting position: 6735
Strain of Virus: B3
Incubation Time (Hours):72
Offtargets for "guacagggauaaacauuac" siRNA in Human Genome sequences
Pubmed:18548221
Article:Cardiac-targeted RNA interference mediated by an AAV9 vector improves cardiac function in coxsackievirus B3 cardiomyopathy.
Authors:Fechner H, Sipo I, Westermann D, Pinkert S, Wang X, Suckau L, Kurreck J, Zeichhardt H, Miller O, Vetter R, Erdmann V, Tschope C, Poller W.
Journal:J Mol Med (Berl). 2008 Sep;86(9):987-97. Epub 2008 Jun 12.
Entrez:18548221
Article:Cardiac-targeted RNA interference mediated by an AAV9 vector improves cardiac function in coxsackievirus B3 cardiomyopathy.
Authors:Fechner H, Sipo I, Westermann D, Pinkert S, Wang X, Suckau L, Kurreck J, Zeichhardt H, Miller O, Vetter R, Erdmann V, Tschope C, Poller W.
Journal:J Mol Med (Berl). 2008 Sep;86(9):987-97. Epub 2008 Jun 12.
Entrez:18548221
siRNA sequence "aaauaccacgucgcaauguggc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaauaccacgucgcaauguggc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1297 " record
Length: 22
GC Content:50 %
Starting position: 222
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 22
GC Content:50 %
Starting position: 222
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aaauaccacgucgcaauguggc" siRNA in Human Genome sequences
See AY268070 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
siRNA sequence "aagcuauucgucacguucgugc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aagcuauucgucacguucgugc" SARS Coronavirus" Virus reference Genome sequences
Browse all the records for "SARS Coronavirus" virus
Browse "virsi1293 " record
Length: 22
GC Content:50 %
Starting position: 486
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 22
GC Content:50 %
Starting position: 486
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY268070
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aagcuauucgucacguucgugc" siRNA in Human Genome sequences
See AY268070 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1835 | cuaaggaccuaacaaaguu | Human Coxsackievirus [CV] |  SL | refseqs |  | |||||
| virsi2189 | guuuacaacuggugagaca | Hepatitis E Virus [HEV] | SL | refseqs |  | |||||
| virsi2188 | cgugaugugucucggauaa | Hepatitis E Virus [HEV] | SL | refseqs |  | |||||
| virsi2190 | ggguuagaguguauaauca | Hepatitis E Virus [HEV] | SL | refseqs |  | |||||
| virsi2187 | guuccgugcuauugagaaa | Hepatitis E Virus [HEV] | SL | refseqs |  | |||||
| virsi1292 | aaggacaugaccuaccguagac | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1296 | aaugucaaccgcuucaauguggc | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1834 | guacagggauaaacauuac | Human Coxsackievirus [CV] | SL | refseqs |  | |||||
| virsi1297 | aaauaccacgucgcaauguggc | SARS Coronavirus | SL | refseqs |  | |||||
| virsi1293 | aagcuauucgucacguucgugc | SARS Coronavirus | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm