Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for VP2 are 3
Results from 0 - 25
siRNA sequence "gcgcaauuaacuauuggcaacucca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gcgcaauuaacuauuggcaacucca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1776 " record
Length: 25
GC Content:44 %
Starting position: 990
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 25
GC Content:44 %
Starting position: 990
Strain of Virus: EV71 Strain Shzh-98
GenBank Acc: AF302996
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gcgcaauuaacuauuggcaacucca" siRNA in Human Genome sequences
See AF302996 at Genbank
Pubmed:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979
Article:Identification of small interfering RNAs which inhibit the replication of several Enterovirus 71 strains in China.
Authors:Wu Z, Yang F, Zhao R, Zhao L, Guo D, Jin Q.
Journal:J Virol Methods. 2009 Aug;159(2):233-8. Epub 2009 Apr 10.
Entrez:19490979
siRNA sequence "gagaaacaaccuagugaug" alignment with "Human Rhinovirus" virus reference Genome sequences
siRNA sequence matching with "gagaaacaaccuagugaug" Human Rhinovirus" Virus reference Genome sequences
Browse all the records for "Human Rhinovirus" virus
Browse "virsi2029 " record
Length: 19
GC Content:42 %
GenBank Acc: L24917
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:42 %
GenBank Acc: L24917
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "gagaaacaaccuagugaug" siRNA in Human Genome sequences
See L24917 at Genbank
Pubmed:14670593
Article:Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.
Authors:Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.
Journal:Antiviral Res. 2004 Jan;61(1):49-55.
Entrez:14670593
Article:Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.
Authors:Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.
Journal:Antiviral Res. 2004 Jan;61(1):49-55.
Entrez:14670593
siRNA sequence "aggaugcaacggcuauaga" alignment with "Human Rhinovirus" virus reference Genome sequences
siRNA sequence matching with "aggaugcaacggcuauaga" Human Rhinovirus" Virus reference Genome sequences
Browse all the records for "Human Rhinovirus" virus
Browse "virsi2028 " record
Length: 19
GC Content:47 %
GenBank Acc: L24917
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Length: 19
GC Content:47 %
GenBank Acc: L24917
Transfection Reagent: Oligofectamine
Incubation Time (Hours):72
Offtargets for "aggaugcaacggcuauaga" siRNA in Human Genome sequences
See L24917 at Genbank
Pubmed:14670593
Article:Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.
Authors:Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.
Journal:Antiviral Res. 2004 Jan;61(1):49-55.
Entrez:14670593
Article:Small interfering RNA molecules as potential anti-human rhinovirus agents: in vitro potency, specificity, and mechanism.
Authors:Phipps KM, Martinez A, Lu J, Heinz BA, Zhao G.
Journal:Antiviral Res. 2004 Jan;61(1):49-55.
Entrez:14670593
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1776 | gcgcaauuaacuauuggcaacucca | Enterovirus [EV] |  SL | refseqs |  | |||||
| virsi2029 | gagaaacaaccuagugaug | Human Rhinovirus |  SL | refseqs |  | |||||
| virsi2028 | aggaugcaacggcuauaga | Human Rhinovirus | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands: siRNA Not specific SL: siRNA seedlocator algorithm