Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for Arenaviridae are 10
Results from 0 - 25
siRNA sequence "ggcccggauggucauuuaa" alignment with "Lymphocytic Choriomeningitis Virus" virus reference Genome sequences
siRNA sequence matching with "ggcccggauggucauuuaa" Lymphocytic Choriomeningitis Virus" Virus reference Genome sequences

Browse all the records for "Lymphocytic Choriomeningitis Virus" virus
Browse "virsi2303 " record
Length: 19
GC Content:53 %
GenBank Acc: NC_004291
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:53 %
GenBank Acc: NC_004291
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ggcccggauggucauuuaa" siRNA in Human Genome sequences
See NC_004291 at Genbank
Pubmed:16103158
Article:RNA interference-mediated virus clearance from cells both acutely and chronically infected with the prototypic arenavirus lymphocytic choriomeningitis virus.
Authors:Sánchez AB, Perez M, Cornu T, de la Torre JC.
Journal:J Virol. 2005 Sep;79(17):11071-81.
Entrez:16103158
Article:RNA interference-mediated virus clearance from cells both acutely and chronically infected with the prototypic arenavirus lymphocytic choriomeningitis virus.
Authors:Sánchez AB, Perez M, Cornu T, de la Torre JC.
Journal:J Virol. 2005 Sep;79(17):11071-81.
Entrez:16103158
siRNA sequence "accuucugcugucaguauccg" alignment with "Lymphocytic Choriomeningitis Virus" virus reference Genome sequences
siRNA sequence matching with "accuucugcugucaguauccg" Lymphocytic Choriomeningitis Virus" Virus reference Genome sequences

Browse all the records for "Lymphocytic Choriomeningitis Virus" virus
Browse "virsi2304 " record
Length: 21
GC Content:52 %
GenBank Acc: NC_004291
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:52 %
GenBank Acc: NC_004291
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "accuucugcugucaguauccg" siRNA in Human Genome sequences
See NC_004291 at Genbank
Pubmed:16103158
Article:RNA interference-mediated virus clearance from cells both acutely and chronically infected with the prototypic arenavirus lymphocytic choriomeningitis virus.
Authors:Sánchez AB, Perez M, Cornu T, de la Torre JC.
Journal:J Virol. 2005 Sep;79(17):11071-81.
Entrez:16103158
Article:RNA interference-mediated virus clearance from cells both acutely and chronically infected with the prototypic arenavirus lymphocytic choriomeningitis virus.
Authors:Sánchez AB, Perez M, Cornu T, de la Torre JC.
Journal:J Virol. 2005 Sep;79(17):11071-81.
Entrez:16103158
siRNA sequence "aacauaaccugaugacacc" alignment with "Junin Virus" virus reference Genome sequences
Browse all the records for "Junin Virus" virus
Browse "virsi2300 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "aacauaaccugaugacacc" siRNA in Human Genome sequences
See DQ538136 at Genbank
Pubmed:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
siRNA sequence "ccugauaaccugcaaugau" alignment with "Junin Virus" virus reference Genome sequences
Browse all the records for "Junin Virus" virus
Browse "virsi2299 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "ccugauaaccugcaaugau" siRNA in Human Genome sequences
See DQ538136 at Genbank
Pubmed:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
siRNA sequence "cgcacaguggauccuaggc" alignment with "Lassa Virus" virus reference Genome sequences
Browse all the records for "Lassa Virus" virus
Browse "virsi1922 " record
Length: 19
GC Content:63 %
Starting position: 1
GenBank Acc: J04324
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:63 %
Starting position: 1
GenBank Acc: J04324
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cgcacaguggauccuaggc" siRNA in Human Genome sequences
See J04324 at Genbank
Pubmed:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
siRNA sequence "uugcagagaucugaauucc" alignment with "Junin Virus" virus reference Genome sequences
Browse all the records for "Junin Virus" virus
Browse "virsi2302 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "uugcagagaucugaauucc" siRNA in Human Genome sequences
See DQ538136 at Genbank
Pubmed:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
siRNA sequence "cgcaccgaggauccuaggc" alignment with "Lassa Virus" virus reference Genome sequences
Browse all the records for "Lassa Virus" virus
Browse "virsi1923 " record
Length: 19
GC Content:68 %
Starting position: 1
GenBank Acc: J04331
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:68 %
Starting position: 1
GenBank Acc: J04331
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cgcaccgaggauccuaggc" siRNA in Human Genome sequences
See J04331 at Genbank
Pubmed:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
siRNA sequence "uaucuaccauguagacugc" alignment with "Junin Virus" virus reference Genome sequences
Browse all the records for "Junin Virus" virus
Browse "virsi2301 " record
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:42 %
GenBank Acc: DQ538136
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "uaucuaccauguagacugc" siRNA in Human Genome sequences
See DQ538136 at Genbank
Pubmed:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
Article:Inhibition of JunÃn virus replication by small interfering RNAs.
Authors:Artuso MC, Ellenberg PC, Scolaro LA, Damonte EB, GarcÃa CC.
Journal:Antiviral Res. 2009 Oct;84(1):31-7. Epub 2009 Jul 8.
Entrez:19591878
siRNA sequence "cgcaccggggauccuaggc" alignment with "Lassa Virus" virus reference Genome sequences
Browse all the records for "Lassa Virus" virus
Browse "virsi1920 " record
Length: 19
GC Content:74 %
Starting position: 1
GenBank Acc: AF246121
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:74 %
Starting position: 1
GenBank Acc: AF246121
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cgcaccggggauccuaggc" siRNA in Human Genome sequences
See AF246121 at Genbank
Pubmed:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
siRNA sequence "cgcaccggggauccuaggc" alignment with "Lassa Virus" virus reference Genome sequences
Browse all the records for "Lassa Virus" virus
Browse "virsi1921 " record
Length: 19
GC Content:74 %
Starting position: 1
GenBank Acc: AF246121
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 19
GC Content:74 %
Starting position: 1
GenBank Acc: AF246121
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "cgcaccggggauccuaggc" siRNA in Human Genome sequences
See AF246121 at Genbank
Pubmed:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
Article:Broad-spectrum antiviral activity of small interfering RNA targeting the conserved RNA termini of Lassa virus.
Authors:Miller S, Genther S.
Journal:Antimicrob Agents Chemother. 2007 Jun;51(6):2215-8. Epub 2007 Mar 19.
Entrez:17371814
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2303 | ggcccggauggucauuuaa | Lymphocytic Choriomeningitis Virus | ![]() | refseqs | ![]() | |||||
virsi2304 | accuucugcugucaguauccg | Lymphocytic Choriomeningitis Virus | ![]() | refseqs | ![]() | |||||
virsi2300 | aacauaaccugaugacacc | Junin Virus | ![]() | refseqs | ![]() | |||||
virsi2299 | ccugauaaccugcaaugau | Junin Virus | ![]() | refseqs | ![]() | |||||
virsi1922 | cgcacaguggauccuaggc | Lassa Virus | ![]() | refseqs | ![]() | |||||
virsi2302 | uugcagagaucugaauucc | Junin Virus | ![]() | refseqs | ![]() | |||||
virsi1923 | cgcaccgaggauccuaggc | Lassa Virus | ![]() | refseqs | ![]() | |||||
virsi2301 | uaucuaccauguagacugc | Junin Virus | ![]() | refseqs | ![]() | |||||
virsi1920 | cgcaccggggauccuaggc | Lassa Virus | ![]() | refseqs | ![]() | |||||
virsi1921 | cgcaccggggauccuaggc | Lassa Virus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm