VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for Polio Virus are 2
Results from 0 - 25

siRNA sequence "gugcgauccagauuuguuuug" alignment with "Polio Virus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Polio Virus" virus
Browse "virsi3002 " record
Length: 21
GC Content:43 %
Starting position: 2417
GenBank Acc: FJ769385
Transfection Reagent: Lipofectamine 2000

Offtargets for "gugcgauccagauuuguuuug" siRNA in Human Genome sequences
See FJ769385 at Genbank
Pubmed:15613331
Article:Poliovirus escape from RNA interference: short interfering RNA-target recognition and implications for therapeutic approaches.
Authors:Gitlin L, Stone JK, Andino R.
Journal:J Virol. 2005 Jan;79(2):1027-35.
Entrez:15613331

siRNA sequence "gcaaaaugaggaauugaau" alignment with "Polio Virus" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Polio Virus" virus
Browse "virsi3003 " record
Length: 19
GC Content:32 %
Starting position: 687
Strain of Virus: L2-2
Transfection Reagent: Lipofectamine 2000

Offtargets for "gcaaaaugaggaauugaau" siRNA in Human Genome sequences
See at Genbank
Pubmed:16157509
Article:Complete cure of persistent virus infections by antiviral siRNAs.
Authors:Saulnier A, Pelletier I, Labadie K, Colbasre-Garapin F.
Journal:Mol Ther. 2006 Jan;13(1):142-50. Epub 2005 Sep 12.
Entrez:16157509


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi3002	gugcgauccagauuuguuuug	Polio Virus	C	HeLa	Viral Titer	81	15613331	Blast SL	refseqs
virsi3003	gcaaaaugaggaauugaau	Polio Virus	5'NC	HEp-2	Viral Titer	80	16157509	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm