Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 15194802 are 1
Results from 0 - 25
siRNA sequence "aagucuuuagggucuucuaccu" alignment with "John Cunningham Virus [JCV]" virus reference Genome sequences
siRNA sequence matching with "aagucuuuagggucuucuaccu" John Cunningham Virus [JCV]" Virus reference Genome sequences
Browse all the records for "John Cunningham Virus [JCV]" virus
Browse "virsi2016 " record
Length: 22
GC Content:41 %
Starting position: 4256
Strain of Virus: Mad-1
GenBank Acc: NC_001699
Length: 22
GC Content:41 %
Starting position: 4256
Strain of Virus: Mad-1
GenBank Acc: NC_001699
Offtargets for "aagucuuuagggucuucuaccu" siRNA in Human Genome sequences
See NC_001699 at Genbank
Pubmed:15194802
Article:Intracellular approach for blocking JC virus gene expression by using RNA interference during viral infection.
Authors:Radhakrishnan S, Gordon J, Del Valle L, Cui J, Khalili K.
Journal:J Virol. 2004 Jul;78(13):7264-9.
Entrez:15194802
Article:Intracellular approach for blocking JC virus gene expression by using RNA interference during viral infection.
Authors:Radhakrishnan S, Gordon J, Del Valle L, Cui J, Khalili K.
Journal:J Virol. 2004 Jul;78(13):7264-9.
Entrez:15194802
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2016 | aagucuuuagggucuucuaccu | John Cunningham Virus [JCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm