Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 15378775 are 3
Results from 0 - 25
siRNA sequence "uucgcaguccccaaccucc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uucgcaguccccaaccucc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1136 " record
Length: 19
GC Content:63 %
Starting position: 310
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE 6 Cationic Liposome
Incubation Time (Hours):72
Length: 19
GC Content:63 %
Starting position: 310
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE 6 Cationic Liposome
Incubation Time (Hours):72
Offtargets for "uucgcaguccccaaccucc" siRNA in Human Genome sequences
See AF286594 at Genbank
Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775
siRNA sequence "gaagaacucccucgccucg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaagaacucccucgccucg" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1138 " record
Length: 19
GC Content:63 %
Starting position: 2373
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE
Incubation Time (Hours):72
Length: 19
GC Content:63 %
Starting position: 2373
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE
Incubation Time (Hours):72
Offtargets for "gaagaacucccucgccucg" siRNA in Human Genome sequences
See AF286594 at Genbank
Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775
siRNA sequence "gccuccaagcugugccuuggg" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccuccaagcugugccuuggg" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1137 " record
Length: 21
GC Content:67 %
Starting position: 1868
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE
Incubation Time (Hours):72
Length: 21
GC Content:67 %
Starting position: 1868
Strain of Virus: adr
GenBank Acc: AF286594
Transfection Reagent: FuGENE
Incubation Time (Hours):72
Offtargets for "gccuccaagcugugccuuggg" siRNA in Human Genome sequences
See AF286594 at Genbank
Pubmed:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775
Article:siRNA-mediated inhibition of HBV replication and expression.
Authors:Zhang XN, Xiong W, Wang JD, Hu YW, Xiang L, Yuan ZH.
Journal:World J Gastroenterol. 2004 Oct 15;10(20):2967-71.
Entrez:15378775
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1136 | uucgcaguccccaaccucc | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1138 | gaagaacucccucgccucg | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1137 | gccuccaagcugugccuuggg | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm