VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 15763658 are 2
Results from 0 - 25

siRNA sequence "aagagcugaaacaacuauac" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aagagcugaaacaacuauac" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2181 " record
Length: 20
GC Content:35 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aagagcugaaacaacuauac" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658

siRNA sequence "aacugcgacgugagguauaug" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "aacugcgacgugagguauaug" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi2182 " record
Length: 21
GC Content:48 %
Strain of Virus: 16
GenBank Acc: NC_001526
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48

Offtargets for "aacugcgacgugagguauaug" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:15763658
Article:Human papillomavirus-16 associated squamous cell carcinoma of the head and neck (SCCHN): a natural disease model provides insights into viral carcinogenesis.
Authors:Ferris RL, Martinez I, Sirianni N, Wang J, López-Albaitero A, Gollin SM, Johnson JT, Khan S.
Journal:Eur J Cancer. 2005 Mar;41(5):807-15.
Entrez:15763658


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2181	aagagcugaaacaacuauac	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	Medium	15763658	Blast SL	refseqs
virsi2182	aacugcgacgugagguauaug	Human Papillomavirus [HPV]	E6	Upci:Scc090	mRNA	High	15763658	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm