Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 16140767 are 6
Results from 0 - 25
siRNA sequence "gaauacgcuguguuuacau" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1912 " record
Length: 19
GC Content:37 %
Starting position: 83777
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Length: 19
GC Content:37 %
Starting position: 83777
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Offtargets for "gaauacgcuguguuuacau" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
siRNA sequence "auagcgcaucugccgaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1913 " record
Length: 19
GC Content:53 %
Starting position: 84287
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Starting position: 84287
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Offtargets for "auagcgcaucugccgaaag" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
siRNA sequence "atcggtgtgtatgctaaag" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1915 " record
Length: 19
GC Content:42 %
Starting position: 1390
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 1390
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48
Offtargets for "atcggtgtgtatgctaaag" siRNA in Human Genome sequences
See Z18287 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
siRNA sequence "gtgaaacgatgtgttataa" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1916 " record
Length: 19
GC Content:32 %
Starting position: 2087
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48
Length: 19
GC Content:32 %
Starting position: 2087
Strain of Virus: HHV-6
GenBank Acc: Z18287
Incubation Time (Hours):48
Offtargets for "gtgaaacgatgtgttataa" siRNA in Human Genome sequences
See Z18287 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
siRNA sequence "gucggucgagaauacgcugug" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1911 " record
Length: 21
GC Content:57 %
Starting position: 83768
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Length: 21
GC Content:57 %
Starting position: 83768
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Offtargets for "gucggucgagaauacgcugug" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
siRNA sequence "guaucuggcuggucaauuu" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1914 " record
Length: 19
GC Content:42 %
Starting position: 84453
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Length: 19
GC Content:42 %
Starting position: 84453
Strain of Virus: HHV-6
GenBank Acc: AB021506
Incubation Time (Hours):48
Offtargets for "guaucuggcuggucaauuu" siRNA in Human Genome sequences
See AB021506 at Genbank
Pubmed:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
Article:The human herpesvirus 6 G protein-coupled receptor homolog U51 positively regulates virus replication and enhances cell-cell fusion in vitro.
Authors:Zhen Z, Bradel-Tretheway B, Sumagin S, Bidlack JM, Dewhurst S.
Journal:J Virol. 2005 Sep;79(18):11914-24.
Entrez:16140767
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1912 | gaauacgcuguguuuacau | Herpes Simplex Virus [HSV] |  SL | refseqs |  | |||||
| virsi1913 | auagcgcaucugccgaaag | Herpes Simplex Virus [HSV] | SL | refseqs |  | |||||
| virsi1915 | atcggtgtgtatgctaaag | Herpes Simplex Virus [HSV] | SL | refseqs |  | |||||
| virsi1916 | gtgaaacgatgtgttataa | Herpes Simplex Virus [HSV] | SL | refseqs |  | |||||
| virsi1911 | gucggucgagaauacgcugug | Herpes Simplex Virus [HSV] | SL | refseqs |  | |||||
| virsi1914 | guaucuggcuggucaauuu | Herpes Simplex Virus [HSV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm