VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 17245534 are 3
Results from 0 - 25

siRNA sequence "uuuggaagagaaaccguua" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uuuggaagagaaaccguua" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1443 " record
Length: 19
GC Content:37 %
Starting position: 2229
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):168

Offtargets for "uuuggaagagaaaccguua" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534

siRNA sequence "gucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1444 " record
Length: 19
GC Content:47 %
Starting position: 765
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120

Offtargets for "gucuguacagcaucuugag" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534

siRNA sequence "cgaccgaccuugaggcauacu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "cgaccgaccuugaggcauacu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1442 " record
Length: 21
GC Content:57 %
Starting position: 1689
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):120

Offtargets for "cgaccgaccuugaggcauacu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:17245534
Article:Inhibition of hepatitis B virus replication by shRNAs in stably HBV expressed HEPG2 2.2.15 cell lines.
Authors:Kayhan H, Karatayli E, Turkyilmaz AR, Sahin F, Yurdaydin C, Bozdayi AM.
Journal:Arch Virol. 2007;152(5):871-9. Epub 2007 Jan 25.
Entrez:17245534


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1443	uuuggaagagaaaccguua	Hepatitis B Virus [HBV]	C	HepG2.2.15	Viral Load	79	17245534	Blast SL	refseqs
virsi1444	gucuguacagcaucuugag	Hepatitis B Virus [HBV]	S	HepG2.2.15	Viral Load	73	17245534	Blast SL	refseqs
virsi1442	cgaccgaccuugaggcauacu	Hepatitis B Virus [HBV]	X	HepG2.2.15	Viral Load	72	17245534	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm