Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 17300745 are 4
Results from 0 - 25
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1016 | aagaucucaaucucgggaauc | Hepatitis B Virus [HBV] | ![]() | refseqs |      ![]() | |||||
virsi1017 | cagguccccuagaagaagaac | Hepatitis B Virus [HBV] | ![]() | refseqs |      ![]() | |||||
virsi1018 | aacacuuccggaaacuacugu | Hepatitis B Virus [HBV] | ![]() | refseqs |      ![]() | |||||
virsi1019 | gaucucaaucucgggaaccucaa | Hepatitis B Virus [HBV] | ![]() | refseqs |      ![]() |
![](images/green1.jpeg)
![](images/blue1.jpeg)
![](images/red1.jpeg)
SL: siRNA seedlocator algorithm