Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 17712333 are 2
Results from 0 - 25
siRNA sequence "gaaauuggcucgaauuguu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gaaauuggcucgaauuguu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1774 " record
Length: 19
GC Content:37 %
Starting position: 7306
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 19
GC Content:37 %
Starting position: 7306
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "gaaauuggcucgaauuguu" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333
siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1775 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1774 | gaaauuggcucgaauuguu | Enterovirus [EV] |  SL | refseqs |  | |||||
| virsi1775 | agaaauuggcucgaauuguuuuaauauua | Enterovirus [EV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm