Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 18664330 are 3
Results from 0 - 25
siRNA sequence "ggacggagauuacacaguuua" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1889 " record
Length: 21
GC Content:43 %
Starting position: 139052
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 139052
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48
Offtargets for "ggacggagauuacacaguuua" siRNA in Human Genome sequences
See NC_001806 at Genbank
Pubmed:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330
siRNA sequence "ggaacuacuaugacagcuuca" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1888 " record
Length: 21
GC Content:43 %
Starting position: 138897
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 138897
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48
Offtargets for "ggaacuacuaugacagcuuca" siRNA in Human Genome sequences
See NC_001806 at Genbank
Pubmed:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330
siRNA sequence "ggaauuguguacuggaugcgc" alignment with "Herpes Simplex Virus [HSV]" virus reference Genome sequences
Sorry unable to load image
Browse all the records for "Herpes Simplex Virus [HSV]" virus
Browse "virsi1890 " record
Length: 21
GC Content:52 %
Starting position: 139534
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48
Length: 21
GC Content:52 %
Starting position: 139534
Strain of Virus: HSV-1 Strain 17
GenBank Acc: NC_001806
Transfection Reagent: Lipofectin
Incubation Time (Hours):48
Offtargets for "ggaauuguguacuggaugcgc" siRNA in Human Genome sequences
See NC_001806 at Genbank
Pubmed:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330
Article:Short hairpin RNA-mediated inhibition of HSV-1 gene expression and function during HSV-1 infection in Vero cells.
Authors:Liu YY, Deng HY, Yang G, Jiang WL, Grossin L, Yang ZQ.
Journal:Acta Pharmacol Sin. 2008 Aug;29(8):975-82.
Entrez:18664330
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1889 | ggacggagauuacacaguuua | Herpes Simplex Virus [HSV] |  SL | refseqs |  | |||||
| virsi1888 | ggaacuacuaugacagcuuca | Herpes Simplex Virus [HSV] | SL | refseqs |  | |||||
| virsi1890 | ggaauuguguacuggaugcgc | Herpes Simplex Virus [HSV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm