Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 20622325 are 1
Results from 0 - 25
siRNA sequence "uccuacuguucaagccuccaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "uccuacuguucaagccuccaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1951 " record
Length: 21
GC Content:48 %
Starting position: 42
GenBank Acc: HQ641710
Transfection Reagent: Magnetic Nanoparticles
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Starting position: 42
GenBank Acc: HQ641710
Transfection Reagent: Magnetic Nanoparticles
Incubation Time (Hours):48
Offtargets for "uccuacuguucaagccuccaa" siRNA in Human Genome sequences
See HQ641710 at Genbank
Pubmed:20622325
Article:Inhibition of HBV-DNA replication and expression by siRNA based on magnetic nanoparticles transfering in HepG2 2.2.15 cells.
Authors:He Y, Jiang Y, Wang G, Luo H, Xiao X, Deng C, Luo K, Su X.
Journal:Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2010 Jun;35(6):543-8.
Entrez:20622325
Article:Inhibition of HBV-DNA replication and expression by siRNA based on magnetic nanoparticles transfering in HepG2 2.2.15 cells.
Authors:He Y, Jiang Y, Wang G, Luo H, Xiao X, Deng C, Luo K, Su X.
Journal:Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2010 Jun;35(6):543-8.
Entrez:20622325
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1951 | uccuacuguucaagccuccaa | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm