Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1151 are 1
Results from 0 - 25
siRNA sequence "aaauugcaccuguauucccau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaauugcaccuguauucccau" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1151 " record
Length: 21
GC Content:38 %
Starting position: 591
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 21
GC Content:38 %
Starting position: 591
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "aaauugcaccuguauucccau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967
Article:Inhibition of hepatitis B virus replication by various RNAi constructs and their pharmacodynamic properties.
Authors:Peng J, Zhao Y, Mai J, Pang WK, Wei X, Zhang P, Xu Y.
Journal:J Gen Virol. 2005 Dec;86(Pt 12):3227-34.
Entrez:16298967
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1151 | aaauugcaccuguauucccau | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm