Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1300 are 1
Results from 0 - 25
siRNA sequence "aaaccaacgguuuacgucuac" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "aaaccaacgguuuacgucuac" SARS Coronavirus" Virus reference Genome sequences

Browse all the records for "SARS Coronavirus" virus
Browse "virsi1300 " record
Length: 21
GC Content:43 %
Starting position: 220
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY451891
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 220
Strain of Virus: TW-PH2_SC27 Isolate
GenBank Acc: AY451891
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aaaccaacgguuuacgucuac" siRNA in Human Genome sequences
See AY451891 at Genbank
Pubmed:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
Article:Identification of effective siRNA blocking the expression of SARS viral envelope E and RDRP genes.
Authors:Meng B, Lui YW, Meng S, Cao C, Hu Y.
Journal:Mol Biotechnol. 2006 Jun;33(2):141-8.
Entrez:16757801
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1300 | aaaccaacgguuuacgucuac | SARS Coronavirus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm