Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1337 are 1
Results from 0 - 25
siRNA sequence "caagccucuucucgcuccuc" alignment with "SARS Coronavirus" virus reference Genome sequences
siRNA sequence matching with "caagccucuucucgcuccuc" SARS Coronavirus" Virus reference Genome sequences

Browse all the records for "SARS Coronavirus" virus
Browse "virsi1337 " record
Length: 20
GC Content:60 %
Starting position: 28648
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Length: 20
GC Content:60 %
Starting position: 28648
Strain of Virus: GZ50
GenBank Acc: AY304495
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24
Offtargets for "caagccucuucucgcuccuc" siRNA in Human Genome sequences
See AY304495 at Genbank
Pubmed:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
Article:Kinetics and synergistic effects of siRNAs targeting structural and replicase genes of SARS-associated coronavirus.
Authors:He ML, Zheng BJ, Chen Y, Wong KL, Huang JD, Lin MC, Peng Y, Yuen KY, Sung JJ, Kung HF.
Journal:FEBS Lett. 2006 May 1;580(10):2414-20. Epub 2006 Mar 30.
Entrez:16638566
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1337 | caagccucuucucgcuccuc | SARS Coronavirus | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm