Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1450 are 1
Results from 0 - 25
siRNA sequence "gggaccaugcagaaccugcacgauu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gggaccaugcagaaccugcacgauu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1450 " record
Length: 25
GC Content:56 %
Starting position: 508
Transfection Reagent: Lipofectamine 2000
Length: 25
GC Content:56 %
Starting position: 508
Transfection Reagent: Lipofectamine 2000
Offtargets for "gggaccaugcagaaccugcacgauu" siRNA in Human Genome sequences
Pubmed:17588164
Article:Two approaches to construct mammalian expression vector of shRNA to reduce expression and replication of HBV in vitro.
Authors:Zhang HB, Wu J, Xian J, Pei L, Wang J.
Journal:Mol Biol Rep. 2008 Sep;35(3):465-72. Epub 2007 Jun 22.
Entrez:17588164
Article:Two approaches to construct mammalian expression vector of shRNA to reduce expression and replication of HBV in vitro.
Authors:Zhang HB, Wu J, Xian J, Pei L, Wang J.
Journal:Mol Biol Rep. 2008 Sep;35(3):465-72. Epub 2007 Jun 22.
Entrez:17588164
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1450 | gggaccaugcagaaccugcacgauu | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm