Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1666 are 1
Results from 0 - 25
siRNA sequence "aaugucaacaaccgaccuuga" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaugucaacaaccgaccuuga" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1666 " record
Length: 21
GC Content:43 %
Starting position: 306
Strain of Virus: adw
GenBank Acc: GQ855357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 306
Strain of Virus: adw
GenBank Acc: GQ855357
Transfection Reagent: Oligofectamine
Incubation Time (Hours):48
Offtargets for "aaugucaacaaccgaccuuga" siRNA in Human Genome sequences
See GQ855357 at Genbank
Pubmed:17296261
Article:RNA interference targeting HBx suppresses tumor growth and enhances cisplatin chemosensitivity in human hepatocellular carcinoma.
Authors:Cheng AS, Wong N, Tse AM, Chan KY, Chan KK, Sung JJ, Chan HL.
Journal:Cancer Lett. 2007 Aug 8;253(1):43-52. Epub 2007 Feb 12.
Entrez:17296261
Article:RNA interference targeting HBx suppresses tumor growth and enhances cisplatin chemosensitivity in human hepatocellular carcinoma.
Authors:Cheng AS, Wong N, Tse AM, Chan KY, Chan KK, Sung JJ, Chan HL.
Journal:Cancer Lett. 2007 Aug 8;253(1):43-52. Epub 2007 Feb 12.
Entrez:17296261
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1666 | aaugucaacaaccgaccuuga | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm