Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1668 are 1
Results from 0 - 25
siRNA sequence "acgacagucaauugcagacaa" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "acgacagucaauugcagacaa" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1668 " record
Length: 21
GC Content:43 %
Starting position: 632
GenBank Acc: M19183
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Length: 21
GC Content:43 %
Starting position: 632
GenBank Acc: M19183
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72
Offtargets for "acgacagucaauugcagacaa" siRNA in Human Genome sequences
See M19183 at Genbank
Pubmed:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272
Article:Inhibition of woodchuck hepatitis virus gene expression in primary hepatocytes by siRNA enhances the cellular gene expression.
Authors:Meng Z, Qiu S, Zhang X, Wu J, Schreiter T, Xu Y, Yang D, Roggendorf M, Schlaak J, Lu M.
Journal:Virology. 2009 Feb 5;384(1):88-96. Epub 2008 Dec 6.
Entrez:19064272
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1668 | acgacagucaauugcagacaa | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm