VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for virsi1713 are 1
Results from 0 - 25

siRNA sequence "gagguauaugacuuugcuuuu" alignment with "Human Papillomavirus [HPV]" virus reference Genome sequences
siRNA sequence matching with "gagguauaugacuuugcuuuu" Human Papillomavirus [HPV]" Virus reference Genome sequences
Browse all the records for "Human Papillomavirus [HPV]" virus
Browse "virsi1713 " record
Length: 21
GC Content:33 %
Starting position: 224
Strain of Virus: HPV16
GenBank Acc: NC_001526
Transfection Reagent: Lipofectamine
Incubation Time (Hours):24

Offtargets for "gagguauaugacuuugcuuuu" siRNA in Human Genome sequences
See NC_001526 at Genbank
Pubmed:19174559
Article:Inhibition of cervical cancer cell growth by human papillomavirus virus-like particles packaged with human papillomavirus oncoprotein short hairpin RNAs.
Authors:Bousarghin L, Touze A, Gaud G, Iochmann S, Alvarez E, Reverdiau P, Gaitan J, Jourdan ML, Sizaret PY, Coursaget PL.
Journal:Mol Cancer Ther. 2009 Feb;8(2):357-65. Epub 2009 Jan 27.
Entrez:19174559


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1713	gagguauaugacuuugcuuuu	Human Papillomavirus [HPV]	E6	CaSki	mRNA	100	19174559	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm