Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1933 are 1
Results from 0 - 25
siRNA sequence "aaagagagucaauccguucuu" alignment with "Henipavirus" virus reference Genome sequences
Browse all the records for "Henipavirus" virus
Browse "virsi1933 " record
Length: 21
GC Content:38 %
Starting position: 712
Strain of Virus: Niv
GenBank Acc: AJ564622
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Length: 21
GC Content:38 %
Starting position: 712
Strain of Virus: Niv
GenBank Acc: AJ564622
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):24
Offtargets for "aaagagagucaauccguucuu" siRNA in Human Genome sequences
See AJ564622 at Genbank
Pubmed:18687361
Article:Inhibition of Henipavirus infection by RNA interference.
Authors:Mungall BA, Schopman NC, Lambeth LS, Doran TJ.
Journal:Antiviral Res. 2008 Dec;80(3):324-31. Epub 2008 Aug 5.
Entrez:18687361
Article:Inhibition of Henipavirus infection by RNA interference.
Authors:Mungall BA, Schopman NC, Lambeth LS, Doran TJ.
Journal:Antiviral Res. 2008 Dec;80(3):324-31. Epub 2008 Aug 5.
Entrez:18687361
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1933 | aaagagagucaauccguucuu | Henipavirus |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm