Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1957 are 1
Results from 0 - 25
siRNA sequence "aaagcucaucggaacugacaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaagcucaucggaacugacaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1957 " record
Length: 22
GC Content:41 %
Starting position: 1317
Strain of Virus: adw
GenBank Acc: AM282986
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 22
GC Content:41 %
Starting position: 1317
Strain of Virus: adw
GenBank Acc: AM282986
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aaagcucaucggaacugacaau" siRNA in Human Genome sequences
See AM282986 at Genbank
Pubmed:20822550
Article:Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element.
Authors:Panjaworayan N, Payungporn S, Poovorawan Y, Brown CM.
Journal:Virol J. 2010 Sep 8;7:216.
Entrez:20822550
Article:Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element.
Authors:Panjaworayan N, Payungporn S, Poovorawan Y, Brown CM.
Journal:Virol J. 2010 Sep 8;7:216.
Entrez:20822550
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1957 | aaagcucaucggaacugacaau | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm