Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi1958 are 1
Results from 0 - 25
siRNA sequence "aacugacaauucugucguccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aacugacaauucugucguccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1958 " record
Length: 21
GC Content:43 %
Starting position: 1329
Strain of Virus: adw
GenBank Acc: AM282986
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Starting position: 1329
Strain of Virus: adw
GenBank Acc: AM282986
Transfection Reagent: FuGENE
Incubation Time (Hours):48
Offtargets for "aacugacaauucugucguccu" siRNA in Human Genome sequences
See AM282986 at Genbank
Pubmed:20822550
Article:Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element.
Authors:Panjaworayan N, Payungporn S, Poovorawan Y, Brown CM.
Journal:Virol J. 2010 Sep 8;7:216.
Entrez:20822550
Article:Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element.
Authors:Panjaworayan N, Payungporn S, Poovorawan Y, Brown CM.
Journal:Virol J. 2010 Sep 8;7:216.
Entrez:20822550
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1958 | aacugacaauucugucguccu | Hepatitis B Virus [HBV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm