Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2023 are 1
Results from 0 - 25
siRNA sequence "ggcagcaauucauugaguaug" alignment with "Human Respiratory Syncytial Virus [HRSV]" virus reference Genome sequences
siRNA sequence matching with "ggcagcaauucauugaguaug" Human Respiratory Syncytial Virus [HRSV]" Virus reference Genome sequences

Browse all the records for "Human Respiratory Syncytial Virus [HRSV]" virus
Offtargets for "ggcagcaauucauugaguaug" siRNA in Human Genome sequences
See AF035006 at Genbank
Pubmed:17270047
Article:Respiratory syncytial virus infection in Fischer 344 rats is attenuated by short interfering RNA against the RSV-NS1 gene.
Authors:Kong X, Zhang W, Lockey RF, Auais A, Piedimonte G, Mohapatra SS.
Journal:Genet Vaccines Ther. 2007 Feb 1;5:4.
Entrez:17270047
Article:Respiratory syncytial virus infection in Fischer 344 rats is attenuated by short interfering RNA against the RSV-NS1 gene.
Authors:Kong X, Zhang W, Lockey RF, Auais A, Piedimonte G, Mohapatra SS.
Journal:Genet Vaccines Ther. 2007 Feb 1;5:4.
Entrez:17270047
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi2023 | ggcagcaauucauugaguaug | Human Respiratory Syncytial Virus [HRSV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm