Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for virsi2148 are 1
Results from 0 - 25
siRNA sequence "cucguccccuccggccguacc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "cucguccccuccggccguacc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2148 " record
Length: 21
GC Content:76 %
GenBank Acc: nM_031836
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:76 %
GenBank Acc: nM_031836
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "cucguccccuccggccguacc" siRNA in Human Genome sequences
See nM_031836 at Genbank
Pubmed:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
Article:RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells.
Authors:Wilson JA, Jayasena S, Khvorova A, Sabatinos S, Rodrigue-Gervais IG, Arya S, Sarangi F, Harris-Brandts M, Beaulieu S, Richardson CD.
Journal:Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2783-8. Epub 2003 Feb 19.
Entrez:12594341
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2148 | cucguccccuccggccguacc | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm