VIRmiRNA -A database of viral miRNA
VMR_0626 details

miRNA Id:VMR_0626
Virus:Pseudorabies virus (PRV)
Taxonomy:View
Nomenclature:prv-miR-11-1
miRNA Sequence: agaugaaccuguuccgcccgcuc
Length: 23
Predicted secondary structure (UNAfold):
GC Content (%):60.87
pre-miRNA:prv-miR-11
pre-miRNA Sequence:gguggcagcgggggaggcugggaguggggacggaagacggaagccagaugaaccuguuccgcccgcucucccaccgccuuucccucccc
Arm: 5p
Cell line: PK-15, IB-RS-2, MDBK cells
Method:Deep sequencing
Reference: 22292087
BLAST (miRBase): 8mer seed | 7mer seed
BLAST (VIRmiRNA): 8mer seed | 7mer seed
Align (miRBase): 8mer seed | 7mer seed
Align (VIRmiRNA): 8mer seed | 7mer seed
Align (Human genes): 8mer seed | 7mer seed