VIRmiRNA -A database of viral miRNA
VMR_1265 details

miRNA Id:VMR_1265
Virus:Turnip mosaic virus (TuMV)
Taxonomy:View
Nomenclature:tumv-miR-s80
miRNA Sequence: gagaaguuuauggggaugacg
Length: 21
Predicted secondary structure (UNAfold):
GC Content (%):47.62
pre-miRNA:na
pre-miRNA Sequence:-
Arm: na
Cell line: A.thaliana virus-infected cells
Method:Microarray
Reference: WO 2012/048385 A1
BLAST (miRBase): 8mer seed | 7mer seed
BLAST (VIRmiRNA): 8mer seed | 7mer seed
Align (miRBase): 8mer seed | 7mer seed
Align (VIRmiRNA): 8mer seed | 7mer seed
Align (Human genes): 8mer seed | 7mer seed