VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 3D Pol are 4
Results from 0 - 25

siRNA sequence "gaaauuggcucgaauuguu" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gaaauuggcucgaauuguu" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1774 " record
Length: 19
GC Content:37 %
Starting position: 7306
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "gaaauuggcucgaauuguu" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333

siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1781 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836

siRNA sequence "gcuacuuugggaugca" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gcuacuuugggaugca" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1785 " record
Length: 16
GC Content:50 %
Starting position: 7304
Strain of Virus: EV71 (5865/Sin/000009)
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48

Offtargets for "gcuacuuugggaugca" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:16083932
Article:RNA interference against enterovirus 71 infection.
Authors:Sim AC, Luhur A, Tan TM, Chow VT, Poh CL.
Journal:Virology. 2005 Oct 10;341(1):72-9.
Entrez:16083932

siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1775 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 (5865/ SIN/00009)
GenBank Acc: AF316321
Transfection Reagent: Oligofectamine
Incubation Time (Hours):24

Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17712333
Article:Inhibition of enterovirus 71 in virus-infected mice by RNA interference.
Authors:Tan EL, Tan TM, Tak Kwong Chow V, Poh CL.
Journal:Mol Ther. 2007 Nov;15(11):1931-8. Epub 2007 Aug 21.
Entrez:17712333


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1774	gaaauuggcucgaauuguu	Enterovirus [EV]	3D Pol	RD	mRNA	100	17712333	Blast SL	refseqs
virsi1781	agaaauuggcucgaauuguuuuaauauua	Enterovirus [EV]	3D Pol	RD	Protein	89	17316836	Blast SL	refseqs
virsi1785	gcuacuuugggaugca	Enterovirus [EV]	3D Pol	RD	RNA	78	16083932	Blast SL	refseqs
virsi1775	agaaauuggcucgaauuguuuuaauauua	Enterovirus [EV]	3D Pol	RD	mRNA	0	17712333	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm