Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for NS5B(S) are 4
Results from 0 - 25
siRNA sequence "ggagaugaaggcgaaggcguc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggagaugaaggcgaaggcguc" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1218 " record
Length: 21
GC Content:62 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Length: 21
GC Content:62 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Offtargets for "ggagaugaaggcgaaggcguc" siRNA in Human Genome sequences
Pubmed:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
siRNA sequence "ggucaccuuugacagacug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggucaccuuugacagacug" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1215 " record
Length: 19
GC Content:53 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Offtargets for "ggucaccuuugacagacug" siRNA in Human Genome sequences
Pubmed:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
siRNA sequence "gacacugagacaccaauugac" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gacacugagacaccaauugac" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1220 " record
Length: 21
GC Content:48 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Offtargets for "gacacugagacaccaauugac" siRNA in Human Genome sequences
Pubmed:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
siRNA sequence "ggucaccuuugacagacug" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggucaccuuugacagacug" Hepatitis C Virus [HCV]" Virus reference Genome sequences

Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1214 " record
Length: 19
GC Content:53 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Length: 19
GC Content:53 %
Strain of Virus: Genotype 1b
Incubation Time (Hours):48
Offtargets for "ggucaccuuugacagacug" siRNA in Human Genome sequences
Pubmed:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
Article:Positional effects and strand preference of RNA interference against hepatitis C virus target sequences.
Authors:Smith RM, Smolic R, Volarevic M, Wu GY.
Journal:J Viral Hepat. 2007 Mar;14(3):194-212.
Entrez:17305886
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1218 | ggagaugaaggcgaaggcguc | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() | |||||
virsi1215 | ggucaccuuugacagacug | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() | |||||
virsi1220 | gacacugagacaccaauugac | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() | |||||
virsi1214 | ggucaccuuugacagacug | Hepatitis C Virus [HCV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm