VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for ORF are 3
Results from 0 - 25

siRNA sequence "gaaccucuauguaucccuccu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gaaccucuauguaucccuccu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1453 " record
Length: 21
GC Content:48 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168

Offtargets for "gaaccucuauguaucccuccu" siRNA in Human Genome sequences
See EF103275 at Genbank
Pubmed:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581

siRNA sequence "aagucuguacagcaucuugag" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aagucuguacagcaucuugag" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1454 " record
Length: 21
GC Content:43 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168

Offtargets for "aagucuguacagcaucuugag" siRNA in Human Genome sequences
See EF103275 at Genbank
Pubmed:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581

siRNA sequence "ggacauugacccguauaaagac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ggacauugacccguauaaagac" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1455 " record
Length: 22
GC Content:45 %
GenBank Acc: EF103275
Transfection Reagent: Lipofectamine
Incubation Time (Hours):168

Offtargets for "ggacauugacccguauaaagac" siRNA in Human Genome sequences
See EF103275 at Genbank
Pubmed:18474581
Article:Long-term suppression of hepatitis B virus replication by short hairpin RNA expression using the scaffold/matrix attachment region-based replicating vector system pEPI-1.
Authors:Jenke AC, Wilhelm AD, Orth V, Lipps HJ, Protzer U, Wirth S.
Journal:Antimicrob Agents Chemother. 2008 Jul;52(7):2355-9. Epub 2008 May 12.
Entrez:18474581


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1453	gaaccucuauguaucccuccu	Hepatitis B Virus [HBV]	ORF	HepG2.2.15	Protein	90	18474581	Blast SL	refseqs
virsi1454	aagucuguacagcaucuugag	Hepatitis B Virus [HBV]	ORF	HepG2.2.15	Protein	70	18474581	Blast SL	refseqs
virsi1455	ggacauugacccguauaaagac	Hepatitis B Virus [HBV]	ORF	HepG2.2.15	Protein	55	18474581	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm