Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 16929350 are 3
Results from 0 - 25
siRNA sequence "gguauguugcccguuugucu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuugucu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1458 " record
Length: 20
GC Content:50 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 20
GC Content:50 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gguauguugcccguuugucu" siRNA in Human Genome sequences
Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350
siRNA sequence "ucauguccuacuguucaagu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "ucauguccuacuguucaagu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1457 " record
Length: 20
GC Content:40 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 20
GC Content:40 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "ucauguccuacuguucaagu" siRNA in Human Genome sequences
Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350
siRNA sequence "gccuuagagucuccugagcu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccuuagagucuccugagcu" Hepatitis B Virus [HBV]" Virus reference Genome sequences
Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1456 " record
Length: 20
GC Content:55 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 20
GC Content:55 %
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gccuuagagucuccugagcu" siRNA in Human Genome sequences
Pubmed:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350
Article:Long-term inhibition of hepatitis B virus in transgenic mice by double-stranded adeno-associated virus 8-delivered short hairpin RNA.
Authors:Chen CC, Ko TM, Ma HI, Wu HL, Xiao X, Li J, Chang CM, Wu PY, Chen CH, Han JM, Yu CP, Jeng KS, Hu CP, Tao MH.
Journal:Gene Ther. 2007 Jan;14(1):11-9. Epub 2006 Aug 24.
Entrez:16929350
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi1458 | gguauguugcccguuugucu | Hepatitis B Virus [HBV] |  SL | refseqs |  | |||||
| virsi1457 | ucauguccuacuguucaagu | Hepatitis B Virus [HBV] | SL | refseqs |  | |||||
| virsi1456 | gccuuagagucuccugagcu | Hepatitis B Virus [HBV] | SL | refseqs |  |
: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm