VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 17079316 are 3
Results from 0 - 25

siRNA sequence "aacuacugucuucacgcagaa" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aacuacugucuucacgcagaa" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1185 " record
Length: 21
GC Content:43 %
Starting position: 53
Strain of Virus: Genotype 2a
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "aacuacugucuucacgcagaa" siRNA in Human Genome sequences
See at Genbank
Pubmed:17079316
Article:Small interfering RNA targeted to hepatitis C virus 5' nontranslated region exerts potent antiviral effect.
Authors:Kanda T, Steele R, Ray R, Ray RB.
Journal:J Virol. 2007 Jan;81(2):669-76. Epub 2006 Nov 1.
Entrez:17079316

siRNA sequence "aaaggccuugugguacugccu" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aaaggccuugugguacugccu" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1186 " record
Length: 21
GC Content:52 %
Starting position: 274
Strain of Virus: Genotype 2a
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "aaaggccuugugguacugccu" siRNA in Human Genome sequences
See at Genbank
Pubmed:17079316
Article:Small interfering RNA targeted to hepatitis C virus 5' nontranslated region exerts potent antiviral effect.
Authors:Kanda T, Steele R, Ray R, Ray RB.
Journal:J Virol. 2007 Jan;81(2):669-76. Epub 2006 Nov 1.
Entrez:17079316

siRNA sequence "aaacguaacaccaaccgucgc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "aaacguaacaccaaccgucgc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi1187 " record
Length: 21
GC Content:52 %
Starting position: 375
Strain of Virus: Genotype 2a
Transfection Reagent: Lipofectamine
Incubation Time (Hours):72

Offtargets for "aaacguaacaccaaccgucgc" siRNA in Human Genome sequences
See at Genbank
Pubmed:17079316
Article:Small interfering RNA targeted to hepatitis C virus 5' nontranslated region exerts potent antiviral effect.
Authors:Kanda T, Steele R, Ray R, Ray RB.
Journal:J Virol. 2007 Jan;81(2):669-76. Epub 2006 Nov 1.
Entrez:17079316


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1185	aacuacugucuucacgcagaa	Hepatitis C Virus [HCV]	5'UTR	Huh-7	RNA	90	17079316	Blast SL	refseqs
virsi1186	aaaggccuugugguacugccu	Hepatitis C Virus [HCV]	5'UTR	Huh-7	RNA	89	17079316	Blast SL	refseqs
virsi1187	aaacguaacaccaaccgucgc	Hepatitis C Virus [HCV]	5'UTR	Huh-7	RNA	27	17079316	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm