Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 17112601 are 2
Results from 0 - 25
siRNA sequence "ggaccaaaagaaacaccaucc" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "ggaccaaaagaaacaccaucc" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2216 " record
Length: 21
GC Content:48 %
Strain of Virus: 3a
GenBank Acc: EU266536.
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:48 %
Strain of Virus: 3a
GenBank Acc: EU266536.
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "ggaccaaaagaaacaccaucc" siRNA in Human Genome sequences
See EU266536. at Genbank
Pubmed:17112601
Article:Inhibition of SARS-CoV replication cycle by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/3b and S.
Authors:Akerström S, Mirazimi A, Tan YJ.
Journal:Antiviral Res. 2007 Mar;73(3):219-27. Epub 2006 Nov 7.
Entrez:17112601
Article:Inhibition of SARS-CoV replication cycle by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/3b and S.
Authors:Akerström S, Mirazimi A, Tan YJ.
Journal:Antiviral Res. 2007 Mar;73(3):219-27. Epub 2006 Nov 7.
Entrez:17112601
siRNA sequence "gguuuggguaaagucaucgau" alignment with "Hepatitis C Virus [HCV]" virus reference Genome sequences
siRNA sequence matching with "gguuuggguaaagucaucgau" Hepatitis C Virus [HCV]" Virus reference Genome sequences
Browse all the records for "Hepatitis C Virus [HCV]" virus
Browse "virsi2217 " record
Length: 21
GC Content:43 %
Strain of Virus: 3a
GenBank Acc: EU266536
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Length: 21
GC Content:43 %
Strain of Virus: 3a
GenBank Acc: EU266536
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):48
Offtargets for "gguuuggguaaagucaucgau" siRNA in Human Genome sequences
See EU266536 at Genbank
Pubmed:17112601
Article:Inhibition of SARS-CoV replication cycle by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/3b and S.
Authors:Akerström S, Mirazimi A, Tan YJ.
Journal:Antiviral Res. 2007 Mar;73(3):219-27. Epub 2006 Nov 7.
Entrez:17112601
Article:Inhibition of SARS-CoV replication cycle by small interference RNAs silencing specific SARS proteins, 7a/7b, 3a/3b and S.
Authors:Akerström S, Mirazimi A, Tan YJ.
Journal:Antiviral Res. 2007 Mar;73(3):219-27. Epub 2006 Nov 7.
Entrez:17112601
| VIRsiRNAid | siRNA Sequence |  Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
|---|---|---|---|---|---|---|---|---|---|---|
| virsi2216 | ggaccaaaagaaacaccaucc | Hepatitis C Virus [HCV] |  SL | refseqs |  | |||||
| virsi2217 | gguuuggguaaagucaucgau | Hepatitis C Virus [HCV] |  SL | refseqs |  |
: siRNA specific for both strands: siRNA specific for only one strands
: siRNA Not specific SL: siRNA seedlocator algorithm