VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 17316836 are 3
Results from 0 - 25

siRNA sequence "agcuacuuugcgaguaugcaaggugagau" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agcuacuuugcgaguaugcaaggugagau" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1780 " record
Length: 29
GC Content:45 %
Starting position: 5919
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "agcuacuuugcgaguaugcaaggugagau" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836

siRNA sequence "agaaauuggcucgaauuguuuuaauauua" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "agaaauuggcucgaauuguuuuaauauua" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1781 " record
Length: 29
GC Content:24 %
Starting position: 7305
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "agaaauuggcucgaauuguuuuaauauua" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836

siRNA sequence "gaaccagaucacgaacuuggagcaguccg" alignment with "Enterovirus [EV]" virus reference Genome sequences
siRNA sequence matching with "gaaccagaucacgaacuuggagcaguccg" Enterovirus [EV]" Virus reference Genome sequences
Browse all the records for "Enterovirus [EV]" virus
Browse "virsi1779 " record
Length: 29
GC Content:55 %
Starting position: 4250
Strain of Virus: EV71 Strain 5865/SIN/00009
GenBank Acc: AF316321
Transfection Reagent: Lipofectamine 2000CD
Incubation Time (Hours):48

Offtargets for "gaaccagaucacgaacuuggagcaguccg" siRNA in Human Genome sequences
See AF316321 at Genbank
Pubmed:17316836
Article:Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71.
Authors:Tan EL, Tan TM, Chow VT, Poh CL.
Journal:Antiviral Res. 2007 Apr;74(1):9-15. Epub 2007 Jan 31.
Entrez:17316836


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi1780	agcuacuuugcgaguaugcaaggugagau	Enterovirus [EV]	3C Pro	RD	Protein	89	17316836	Blast SL	refseqs
virsi1781	agaaauuggcucgaauuguuuuaauauua	Enterovirus [EV]	3D Pol	RD	Protein	89	17316836	Blast SL	refseqs
virsi1779	gaaccagaucacgaacuuggagcaguccg	Enterovirus [EV]	2C	RD	Protein	87	17316836	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm