Browse BY
- Family of Virus
- Virus Name
- Gene Name
- Pubmed Id
- VsiRNAid
Total number of Results for 18274934 are 4
Results from 0 - 25
siRNA sequence "gguauguugcccguuuguc" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gguauguugcccguuuguc" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1023 " record
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:53 %
Starting position: 458
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gguauguugcccguuuguc" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
siRNA sequence "gugguggacuucucucaau" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gugguggacuucucucaau" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1020 " record
Length: 19
GC Content:47 %
Starting position: 256
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:47 %
Starting position: 256
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gugguggacuucucucaau" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
siRNA sequence "aaccuccaaucacucaccaac" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "aaccuccaaucacucaccaac" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1021 " record
Length: 21
GC Content:48 %
Starting position: 322
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 21
GC Content:48 %
Starting position: 322
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "aaccuccaaucacucaccaac" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
siRNA sequence "gccucaucuucuuguuggu" alignment with "Hepatitis B Virus [HBV]" virus reference Genome sequences
siRNA sequence matching with "gccucaucuucuuguuggu" Hepatitis B Virus [HBV]" Virus reference Genome sequences

Browse all the records for "Hepatitis B Virus [HBV]" virus
Browse "virsi1022 " record
Length: 19
GC Content:47 %
Starting position: 423
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Length: 19
GC Content:47 %
Starting position: 423
Strain of Virus: ayw
GenBank Acc: U95551
Transfection Reagent: Lipofectamine 2000
Incubation Time (Hours):72
Offtargets for "gccucaucuucuuguuggu" siRNA in Human Genome sequences
See U95551 at Genbank
Pubmed:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
Article:siRNA pool targeting different sites of human hepatitis B surface antigen efficiently inhibits HBV infection.
Authors:Chen Y, Mahato RI.
Journal:J Drug Target. 2008 Feb;16(2):140-8.
Entrez:18274934
VIRsiRNAid | siRNA Sequence | ![]() | ![]() | ![]() | ![]() | ![]() | PMID | Offtarget | Align With | ALIGN0 Result |
---|---|---|---|---|---|---|---|---|---|---|
virsi1023 | gguauguugcccguuuguc | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1020 | gugguggacuucucucaau | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1021 | aaccuccaaucacucaccaac | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() | |||||
virsi1022 | gccucaucuucuuguuggu | Hepatitis B Virus [HBV] | ![]() | refseqs | ![]() |



SL: siRNA seedlocator algorithm