VIRsiRNAdb

Browse BY

• Family of Virus


• Virus Name


• Gene Name


• Pubmed Id


• VsiRNAid

Total number of Results for 21795337 are 15
Results from 0 - 25

siRNA sequence "gggcaaugguugugggcua" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "gggcaaugguugugggcua" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2323 " record
Length: 19
GC Content:58 %
Starting position: 1237
Strain of Virus: DENV-1
GenBank Acc: DVU88535
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "gggcaaugguugugggcua" siRNA in Human Genome sequences
See DVU88535 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ggauggagcuugagagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ggauggagcuugagagaaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2324 " record
Length: 19
GC Content:47 %
Starting position: 9803
Strain of Virus: DENV-1
GenBank Acc: DVU88536
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ggauggagcuugagagaaa" siRNA in Human Genome sequences
See DVU88536 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "aguuguuagucuacguggac" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "aguuguuagucuacguggac" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2331 " record
Length: 20
GC Content:45 %
Starting position: 1
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "aguuguuagucuacguggac" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ugcugaaacgcgagagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ugcugaaacgcgagagaaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2333 " record
Length: 19
GC Content:47 %
Starting position: 140
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ugcugaaacgcgagagaaa" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "cgggaaagacgaagagaua" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "cgggaaagacgaagagaua" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2325 " record
Length: 19
GC Content:47 %
Starting position: 5111
Strain of Virus: DENV-2
GenBank Acc: NC_001474
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "cgggaaagacgaagagaua" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ccaaagagguaguggacaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ccaaagagguaguggacaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2326 " record
Length: 19
GC Content:47 %
Starting position: 9360
Strain of Virus: DENV-2
GenBank Acc: NC_001474
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ccaaagagguaguggacaa" siRNA in Human Genome sequences
See NC_001474 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "gaggaaugcuugugagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "gaggaaugcuugugagaaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2327 " record
Length: 19
GC Content:42 %
Starting position: 8096
Strain of Virus: DENV-3
GenBank Acc: M93130
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "gaggaaugcuugugagaaa" siRNA in Human Genome sequences
See M93130 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ggauggagccuuagagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ggauggagccuuagagaaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2328 " record
Length: 19
GC Content:47 %
Starting position: 9727
Strain of Virus: DENV-3
GenBank Acc: M93130
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ggauggagccuuagagaaa" siRNA in Human Genome sequences
See M93130 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ccaaagagguaguggacaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ccaaagagguaguggacaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2329 " record
Length: 19
GC Content:47 %
Starting position: 9353
Strain of Virus: DENV-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ccaaagagguaguggacaa" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "auuagagagcagaucucug" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "auuagagagcagaucucug" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2332 " record
Length: 19
GC Content:42 %
Starting position: 78
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "auuagagagcagaucucug" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "gguuagaggagaccccucc" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "gguuagaggagaccccucc" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2334 " record
Length: 19
GC Content:63 %
Starting position: 10501
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "gguuagaggagaccccucc" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ggacuagagguuagaggag" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ggacuagagguuagaggag" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2335 " record
Length: 19
GC Content:53 %
Starting position: 10580
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ggacuagagguuagaggag" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "aacagcauauugacgcugg" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "aacagcauauugacgcugg" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2336 " record
Length: 19
GC Content:47 %
Starting position: 10616
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "aacagcauauugacgcugg" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ccagagauccugcugucuc" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ccagagauccugcugucuc" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2337 " record
Length: 19
GC Content:58 %
Starting position: 10641
Strain of Virus: DENV-1-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ccagagauccugcugucuc" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:

siRNA sequence "ggauggagcuuaagagaaa" alignment with "Dengue Virus [DENV]" virus reference Genome sequences
siRNA sequence matching with "ggauggagcuuaagagaaa" Dengue Virus [DENV]" Virus reference Genome sequences
Browse all the records for "Dengue Virus [DENV]" virus
Browse "virsi2330 " record
Length: 19
GC Content:42 %
Starting position: 9798
Strain of Virus: DENV-4
GenBank Acc: AY947539
Transfection Reagent: RNAiMAX
Incubation Time (Hours):48

Offtargets for "ggauggagcuuaagagaaa" siRNA in Human Genome sequences
See AY947539 at Genbank
Pubmed:21795337
Article:Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:


VIRsiRNAid	siRNA Sequence	Virus_Name	Target Region	Cell Line	Test Object	Efficacy	PMID	Offtarget	Align With	ALIGN0 Result
virsi2323	gggcaaugguugugggcua	Dengue Virus [DENV]	E	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2324	ggauggagcuugagagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2331	aguuguuagucuacguggac	Dengue Virus [DENV]	5'UTR	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2333	ugcugaaacgcgagagaaa	Dengue Virus [DENV]	C	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2325	cgggaaagacgaagagaua	Dengue Virus [DENV]	NS3	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2326	ccaaagagguaguggacaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2327	gaggaaugcuugugagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2328	ggauggagccuuagagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2329	ccaaagagguaguggacaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	High	21795337	Blast SL	refseqs
virsi2332	auuagagagcagaucucug	Dengue Virus [DENV]	5'UTR	Huh-7	Plaque Count	0	21795337	Blast SL	refseqs
virsi2334	gguuagaggagaccccucc	Dengue Virus [DENV]	3'UTR	Huh-7	Plaque Count	0	21795337	Blast SL	refseqs
virsi2335	ggacuagagguuagaggag	Dengue Virus [DENV]	3'UTR	Huh-7	Plaque Count	0	21795337	Blast SL	refseqs
virsi2336	aacagcauauugacgcugg	Dengue Virus [DENV]	3'UTR	Huh-7	Plaque Count	0	21795337	Blast SL	refseqs
virsi2337	ccagagauccugcugucuc	Dengue Virus [DENV]	3'UTR	Huh-7	Plaque Count	0	21795337	Blast SL	refseqs
virsi2330	ggauggagcuuaagagaaa	Dengue Virus [DENV]	NS5	Huh-7	Plaque Count	0	21795337	Blast SL	refseqs



: siRNA specific for both strands
: siRNA specific for only one strands
: siRNA Not specific
SL: siRNA seedlocator algorithm