VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi2323 | gggcaaugguugugggcua | Dengue Virus [DENV] | E | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2323.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2324 | ggauggagcuugagagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2324.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2331 | aguuguuagucuacguggac | Dengue Virus [DENV] | 5'UTR | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2331.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2333 | ugcugaaacgcgagagaaa | Dengue Virus [DENV] | C | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2333.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2325 | cgggaaagacgaagagaua | Dengue Virus [DENV] | NS3 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2325.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2326 | ccaaagagguaguggacaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2326.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2327 | gaggaaugcuugugagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2327.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2328 | ggauggagccuuagagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2328.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2329 | ccaaagagguaguggacaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2329.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2332 | auuagagagcagaucucug | Dengue Virus [DENV] | 5'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2332.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2334 | gguuagaggagaccccucc | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2334.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2335 | ggacuagagguuagaggag | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2335.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2336 | aacagcauauugacgcugg | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2336.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2337 | ccagagauccugcugucuc | Dengue Virus [DENV] | 3'UTR | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2337.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi2330 | ggauggagcuuaagagaaa | Dengue Virus [DENV] | NS5 | Huh-7 | Plaque Count | 0 | 21795337 | Blast SL | refseqs |      ![](images/virus/small/virsi2330.jpeg) | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez: