| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 2-Fluoro |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 1 |
| Position of modifications | 0 | 2 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(F)C1O |
| siRNA Sequence | GCAGCACGACUUCUUCAAGUU | CUUGAAGAAGUCGUGCUGCUU |
| siRNA length base-pair | 21 | 21 |
| siRNA name in paper | RNA3 | RNA3 |
| Biological activity | 73.84 percent target mRNA inhibition | |
| Experiment used to check activity | Radioactivity in PAGE | |
| Melting temperature (oC) | NA | |
| Target gene | EGFP gene | |
| siRNA concentration | 50 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 65 Hours | |
| Article title | Improved serum stability and biophysical properties of siRNAs following chemical modifications |
|
| Reference | 18575806 | |