| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 3-Amino |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 1 |
| Position of modifications | 0 | 27 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
NC1C(O)COC1CO |
| siRNA Sequence | CUGGCCUUUCACUACUCCUACGAGCAC | GUGCUCGUAGGAGUAGUGAAAGGCCAG |
| siRNA length base-pair | 27 | 27 |
| siRNA name in paper | 27C | 27C |
| Biological activity | 76 percent target mRNA inhibition | |
| Experiment used to check activity | Dual Luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Luciferase gene | |
| siRNA concentration | 1 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 48 Hours | |
| Article title | Modified 27-nt dsRNAs with dramatically enhanced stability in serum and long-term RNAi activity |
|
| Reference | 17894530 | |