Field | Sense | Antisense |
siRNA chemical modification | 0 | 3-Amino |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 1 |
Position of modifications | 0 | 27 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
NC1C(O)COC1CO |
siRNA Sequence | CUGGCCUUUCACUACUCCUACGAGCAC | GUGCUCGUAGGAGUAGUGAAAGGCCAG |
siRNA length base-pair | 27 | 27 |
siRNA name in paper | 27C | 27C |
Biological activity | 41 percent target mRNA inhibition | |
Experiment used to check activity | Dual Luciferase reporter assay | |
Melting temperature (oC) | NA | |
Target gene | Luciferase gene | |
siRNA concentration | 50 nM | |
Cell or Organism used | HeLa cells | |
Transfection method | Lipofectamine 2000 | |
Duration after transfection | 168 Hours (7 days) | |
Article title | Modified 27-nt dsRNAs with dramatically enhanced stability in serum and long-term RNAi activity |
|
Reference | 17894530 |