| Field | Sense | Antisense |
| siRNA chemical modification | 3-Amino | 0 |
| siRNA modification types | 1 | 0 |
| Overall number of modifications | 1 | 0 |
| Position of modifications | 27 | 0 |
| Modification on sugar or base or phosphate | Sugar | 0 |
| SMILES (Click to view structure & nomenclature) |
NC1C(O)COC1CO |
- |
| siRNA Sequence | CUGGCCUUUCACUACUCCUACGAGCAC | GUGCUCGUAGGAGUAGUGAAAGGCCAG |
| siRNA length base-pair | 27 | 27 |
| siRNA name in paper | 27G | 27G |
| Biological activity | 72 percent target mRNA inhibition | |
| Experiment used to check activity | Dual Luciferase reporter assay | |
| Melting temperature (oC) | NA | |
| Target gene | Luciferase gene | |
| siRNA concentration | 50 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectamine 2000 | |
| Duration after transfection | 168 Hours (7 days) | |
| Article title | Modified 27-nt dsRNAs with dramatically enhanced stability in serum and long-term RNAi activity |
|
| Reference | 17894530 | |