Field | Sense | Antisense |
siRNA chemical modification | 0 | Phosphorothioate |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 18 |
Position of modifications | 0 | 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 |
Modification on sugar or base or phosphate | 0 | Phosphate |
SMILES (Click to view structure & nomenclature) |
- |
OCC1OCC(O)C1OP(O)(S)=O |
siRNA Sequence | AAGUAAGGACCAGAGACAAA | UUUGUCUCUGGUCCUUACUU |
siRNA length base-pair | 20 | 20 |
siRNA name in paper | siRNA-1 | siRNA-1 |
Biological activity | IC-50 = 1.6 nM for target mRNA | |
Experiment used to check activity | mRNA analysis | |
Melting temperature (oC) | NA | |
Target gene | Human PTEN gene | |
siRNA concentration | 1.6 nM | |
Cell or Organism used | HeLa cells | |
Transfection method | Lipofectin (Invitrogen) | |
Duration after transfection | 17 Hours | |
Article title | Improving RNA interference in mammalian cells by 4'-thio-modified small interfering RNA (siRNA): effect on siRNA activity and nuclease stability when used in combination with 2'-O-alkyl modifications |
|
Reference | 16509579 |