Field | Sense | Antisense |
siRNA chemical modification | 0 | 4-Thioribose |
siRNA modification types | 0 | 1 |
Overall number of modifications | 0 | 8 |
Position of modifications | 0 | 1,2,3,5,16,18,19,20 |
Modification on sugar or base or phosphate | 0 | Sugar |
SMILES (Click to view structure & nomenclature) |
- |
OCC1SCC(O)C1O |
siRNA Sequence | AAGUAAGGACCAGAGACAAA | UUUGUCUCUGGUCCUUACUU |
siRNA length base-pair | 20 | 20 |
siRNA name in paper | siRNA-10 | siRNA-10 |
Biological activity | IC-50 = 5.9 nM for target mRNA | |
Experiment used to check activity | mRNA analysis | |
Melting temperature (oC) | NA | |
Target gene | Human PTEN gene | |
siRNA concentration | 5.9 nM | |
Cell or Organism used | HeLa cells | |
Transfection method | Lipofectin (Invitrogen) | |
Duration after transfection | 35 Hours | |
Article title | Improving RNA interference in mammalian cells by 4'-thio-modified small interfering RNA (siRNA): effect on siRNA activity and nuclease stability when used in combination with 2'-O-alkyl modifications |
|
Reference | 16509579 |