| Field | Sense | Antisense |
| siRNA chemical modification | 0 | 4-Thioribose |
| siRNA modification types | 0 | 1 |
| Overall number of modifications | 0 | 8 |
| Position of modifications | 0 | 1,2,3,5,16,18,19,20 |
| Modification on sugar or base or phosphate | 0 | Sugar |
| SMILES (Click to view structure & nomenclature) |
- |
OCC1SCC(O)C1O |
| siRNA Sequence | AAGUAAGGACCAGAGACAAA | UUUGUCUCUGGUCCUUACUU |
| siRNA length base-pair | 20 | 20 |
| siRNA name in paper | siRNA-10 | siRNA-10 |
| Biological activity | IC-50 = 5.9 nM for target mRNA | |
| Experiment used to check activity | mRNA analysis | |
| Melting temperature (oC) | NA | |
| Target gene | Human PTEN gene | |
| siRNA concentration | 5.9 nM | |
| Cell or Organism used | HeLa cells | |
| Transfection method | Lipofectin (Invitrogen) | |
| Duration after transfection | 35 Hours | |
| Article title | Improving RNA interference in mammalian cells by 4'-thio-modified small interfering RNA (siRNA): effect on siRNA activity and nuclease stability when used in combination with 2'-O-alkyl modifications |
|
| Reference | 16509579 | |